Incidental Mutation 'R0919:Anapc1'
ID81573
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Nameanaphase promoting complex subunit 1
Synonyms2610021O03Rik, tsg24, Apc1, Mcpr
MMRRC Submission 039069-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0919 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location128610104-128687391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128617731 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1803 (R1803G)
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499]
Predicted Effect probably benign
Transcript: ENSMUST00000014499
AA Change: R1803G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: R1803G

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151171
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik A G 4: 10,882,462 T124A probably benign Het
Alpk2 C A 18: 65,307,473 C283F probably benign Het
Anapc4 T C 5: 52,855,637 V423A probably benign Het
Arfgef3 A G 10: 18,589,735 I2120T possibly damaging Het
Btaf1 T A 19: 36,990,743 H1109Q probably benign Het
Cfap70 G A 14: 20,404,164 P851S probably benign Het
Clcf1 T A 19: 4,222,198 L103Q probably damaging Het
Col11a2 T A 17: 34,059,150 V1032E possibly damaging Het
Cyp2c38 T G 19: 39,404,669 D318A probably benign Het
Dbpht2 A G 12: 74,299,000 noncoding transcript Het
Dhx34 A C 7: 16,201,958 V893G probably damaging Het
Fsip2 T A 2: 82,985,484 C3854S possibly damaging Het
Htr1a T C 13: 105,444,836 Y195H probably damaging Het
Insr A G 8: 3,158,769 S1231P probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kpna4 A T 3: 69,085,828 probably benign Het
Olfr1032 A G 2: 86,008,640 Y288C possibly damaging Het
Olfr607 A G 7: 103,460,812 I132T probably damaging Het
Olfr671 A T 7: 104,975,312 Y228* probably null Het
Osbpl7 G A 11: 97,056,101 R239H possibly damaging Het
Prkce G A 17: 86,630,160 V674I probably benign Het
Prkrip1 T C 5: 136,197,831 M52V possibly damaging Het
Sash1 A G 10: 8,730,079 M849T probably benign Het
Scaf8 T C 17: 3,197,120 L906S probably damaging Het
Sfmbt2 T C 2: 10,577,571 L676P probably benign Het
Sgsm1 C T 5: 113,258,842 V923I probably damaging Het
Slc38a3 A T 9: 107,655,959 L305Q probably damaging Het
Slc44a5 A G 3: 154,243,586 Y232C probably damaging Het
Spag17 A T 3: 100,071,943 probably benign Het
Synm T C 7: 67,735,347 I414V probably damaging Het
Tbc1d12 C T 19: 38,914,049 H551Y possibly damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Trpc7 C T 13: 56,822,649 probably benign Het
Trpm7 G A 2: 126,831,238 R532C probably damaging Het
Ttn T A 2: 76,946,742 K1485* probably null Het
Txn2 T C 15: 77,927,749 D69G probably damaging Het
U2af2 C T 7: 5,069,434 probably benign Het
Ubn1 T C 16: 5,064,391 Y239H probably damaging Het
Ubtf A G 11: 102,309,777 probably benign Het
Usp49 T A 17: 47,672,451 V127D probably benign Het
Washc2 C T 6: 116,208,264 R20W probably damaging Het
Zscan10 T C 17: 23,610,007 S476P probably damaging Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128645130 splice site probably benign
IGL00704:Anapc1 APN 2 128663984 missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128629729 missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128633408 missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128653170 missense probably benign
IGL02089:Anapc1 APN 2 128663933 missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128659852 missense probably benign
IGL02570:Anapc1 APN 2 128645200 missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128623931 missense probably benign 0.02
IGL02726:Anapc1 APN 2 128659785 missense probably benign 0.05
IGL03265:Anapc1 APN 2 128627197 missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128627113 splice site probably benign
IGL03327:Anapc1 APN 2 128623934 missense probably benign 0.00
R0023:Anapc1 UTSW 2 128678218 missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128623966 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128634711 missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128641340 critical splice donor site probably null
R0467:Anapc1 UTSW 2 128669043 missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128632655 missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128619332 missense probably benign 0.17
R1175:Anapc1 UTSW 2 128680188 missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128617697 missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128617556 missense probably benign 0.44
R1556:Anapc1 UTSW 2 128624899 missense probably benign 0.00
R1567:Anapc1 UTSW 2 128617716 missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128628532 missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128658246 critical splice donor site probably null
R1677:Anapc1 UTSW 2 128676208 missense probably benign 0.09
R1854:Anapc1 UTSW 2 128675890 missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128659788 missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128633415 missense probably benign 0.36
R1984:Anapc1 UTSW 2 128669688 missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128648458 missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128642548 missense probably benign 0.23
R2928:Anapc1 UTSW 2 128680137 missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128642682 missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128642519 missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128627229 intron probably benign
R4359:Anapc1 UTSW 2 128623556 missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128676249 critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128627195 missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128664005 missense probably benign 0.05
R4770:Anapc1 UTSW 2 128686060 splice site probably benign
R4824:Anapc1 UTSW 2 128628690 missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128684594 missense probably benign 0.23
R5016:Anapc1 UTSW 2 128607175 unclassified probably benign
R5063:Anapc1 UTSW 2 128629549 missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128659917 missense probably benign
R5271:Anapc1 UTSW 2 128685985 nonsense probably null
R5363:Anapc1 UTSW 2 128650194 critical splice donor site probably null
R5469:Anapc1 UTSW 2 128675701 nonsense probably null
R5473:Anapc1 UTSW 2 128607195 unclassified probably benign
R5559:Anapc1 UTSW 2 128680434 nonsense probably null
R5631:Anapc1 UTSW 2 128657217 missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128624916 missense probably benign 0.19
R5840:Anapc1 UTSW 2 128607037 unclassified probably benign
R6226:Anapc1 UTSW 2 128650372 missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128672135 nonsense probably null
R6561:Anapc1 UTSW 2 128663999 missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128684534 nonsense probably null
R6799:Anapc1 UTSW 2 128659737 missense probably null 0.38
R6887:Anapc1 UTSW 2 128659768 missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128669900 missense probably benign 0.06
R7011:Anapc1 UTSW 2 128648681 intron probably null
R7041:Anapc1 UTSW 2 128628656 missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128615430 missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128678274 missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128674602 missense probably benign 0.33
R7123:Anapc1 UTSW 2 128613010 missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128674684 missense probably damaging 0.96
X0066:Anapc1 UTSW 2 128674701 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CACCATACCTTGTAGCCACTGGTC -3'
(R):5'- GCCCTCATGTTGAAGAAAGTGAGCC -3'

Sequencing Primer
(F):5'- TGGTCCAGGGTAGCATCAAC -3'
(R):5'- GAGGGCTCCTTAGTGTAGTCAAC -3'
Posted On2013-11-07