Mutagenetix > Incidental Mutation

Incidental Mutation 'R0919:Anapc1'

81573

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

Apc1, tsg24, Mcpr, 2610021O03Rik

MMRRC Submission

039069-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0919 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128452024-128529311 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128459651 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 1803 (R1803G)

Ref Sequence

ENSEMBL: ENSMUSP00000014499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499]

AlphaFold

P53995

Predicted Effect

probably benign
Transcript: ENSMUST00000014499
AA Change: R1803G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: R1803G

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145906

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151171

Meta Mutation Damage Score

0.0601

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.6%

Validation Efficiency

96% (43/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk2	C	A	18: 65,440,544 (GRCm39)	C283F	probably benign	Het
Anapc4	T	C	5: 53,012,979 (GRCm39)	V423A	probably benign	Het
Arfgef3	A	G	10: 18,465,483 (GRCm39)	I2120T	possibly damaging	Het
Btaf1	T	A	19: 36,968,143 (GRCm39)	H1109Q	probably benign	Het
Cfap418	A	G	4: 10,882,462 (GRCm39)	T124A	probably benign	Het
Cfap70	G	A	14: 20,454,232 (GRCm39)	P851S	probably benign	Het
Clcf1	T	A	19: 4,272,252 (GRCm39)	L103Q	probably damaging	Het
Col11a2	T	A	17: 34,278,124 (GRCm39)	V1032E	possibly damaging	Het
Cyp2c38	T	G	19: 39,393,113 (GRCm39)	D318A	probably benign	Het
Dbpht2	A	G	12: 74,345,774 (GRCm39)		noncoding transcript	Het
Dhx34	A	C	7: 15,935,883 (GRCm39)	V893G	probably damaging	Het
Fsip2	T	A	2: 82,815,828 (GRCm39)	C3854S	possibly damaging	Het
Htr1a	T	C	13: 105,581,344 (GRCm39)	Y195H	probably damaging	Het
Insr	A	G	8: 3,208,769 (GRCm39)	S1231P	probably damaging	Het
Itga10	C	T	3: 96,559,054 (GRCm39)		probably benign	Het
Kpna4	A	T	3: 68,993,161 (GRCm39)		probably benign	Het
Or52d13	A	G	7: 103,110,019 (GRCm39)	I132T	probably damaging	Het
Or52e8	A	T	7: 104,624,519 (GRCm39)	Y228*	probably null	Het
Or5m3	A	G	2: 85,838,984 (GRCm39)	Y288C	possibly damaging	Het
Osbpl7	G	A	11: 96,946,927 (GRCm39)	R239H	possibly damaging	Het
Prkce	G	A	17: 86,937,588 (GRCm39)	V674I	probably benign	Het
Prkrip1	T	C	5: 136,226,685 (GRCm39)	M52V	possibly damaging	Het
Sash1	A	G	10: 8,605,843 (GRCm39)	M849T	probably benign	Het
Scaf8	T	C	17: 3,247,395 (GRCm39)	L906S	probably damaging	Het
Sfmbt2	T	C	2: 10,582,382 (GRCm39)	L676P	probably benign	Het
Sgsm1	C	T	5: 113,406,708 (GRCm39)	V923I	probably damaging	Het
Slc38a3	A	T	9: 107,533,158 (GRCm39)	L305Q	probably damaging	Het
Slc44a5	A	G	3: 153,949,223 (GRCm39)	Y232C	probably damaging	Het
Spag17	A	T	3: 99,979,259 (GRCm39)		probably benign	Het
Synm	T	C	7: 67,385,095 (GRCm39)	I414V	probably damaging	Het
Tbc1d12	C	T	19: 38,902,493 (GRCm39)	H551Y	possibly damaging	Het
Timm21	G	C	18: 84,967,387 (GRCm39)	L130V	probably damaging	Het
Trpc7	C	T	13: 56,970,462 (GRCm39)		probably benign	Het
Trpm7	G	A	2: 126,673,158 (GRCm39)	R532C	probably damaging	Het
Ttn	T	A	2: 76,777,086 (GRCm39)	K1485*	probably null	Het
Txn2	T	C	15: 77,811,949 (GRCm39)	D69G	probably damaging	Het
U2af2	C	T	7: 5,072,433 (GRCm39)		probably benign	Het
Ubn1	T	C	16: 4,882,255 (GRCm39)	Y239H	probably damaging	Het
Ubtf	A	G	11: 102,200,603 (GRCm39)		probably benign	Het
Usp49	T	A	17: 47,983,376 (GRCm39)	V127D	probably benign	Het
Washc2	C	T	6: 116,185,225 (GRCm39)	R20W	probably damaging	Het
Zscan10	T	C	17: 23,828,981 (GRCm39)	S476P	probably damaging	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128,487,050 (GRCm39)	splice site	probably benign
IGL00704:Anapc1	APN	2	128,505,904 (GRCm39)	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128,471,649 (GRCm39)	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128,475,328 (GRCm39)	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128,495,090 (GRCm39)	missense	probably benign
IGL02089:Anapc1	APN	2	128,505,853 (GRCm39)	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128,501,772 (GRCm39)	missense	probably benign
IGL02570:Anapc1	APN	2	128,487,120 (GRCm39)	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128,465,851 (GRCm39)	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128,501,705 (GRCm39)	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128,469,117 (GRCm39)	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128,469,033 (GRCm39)	splice site	probably benign
IGL03327:Anapc1	APN	2	128,465,854 (GRCm39)	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128,520,138 (GRCm39)	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128,483,431 (GRCm39)	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128,483,431 (GRCm39)	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128,465,886 (GRCm39)	splice site	probably benign
R0103:Anapc1	UTSW	2	128,522,372 (GRCm39)	splice site	probably benign
R0103:Anapc1	UTSW	2	128,522,372 (GRCm39)	splice site	probably benign
R0109:Anapc1	UTSW	2	128,476,613 (GRCm39)	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128,476,613 (GRCm39)	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128,470,549 (GRCm39)	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128,470,549 (GRCm39)	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128,476,631 (GRCm39)	missense	probably damaging	0.99
R0377:Anapc1	UTSW	2	128,483,260 (GRCm39)	critical splice donor site	probably null
R0467:Anapc1	UTSW	2	128,510,963 (GRCm39)	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128,474,575 (GRCm39)	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128,461,252 (GRCm39)	missense	probably benign	0.17
R1175:Anapc1	UTSW	2	128,522,108 (GRCm39)	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128,459,617 (GRCm39)	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128,459,476 (GRCm39)	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128,466,819 (GRCm39)	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128,459,636 (GRCm39)	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128,470,452 (GRCm39)	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128,500,166 (GRCm39)	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128,518,128 (GRCm39)	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128,517,810 (GRCm39)	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128,501,708 (GRCm39)	missense	probably damaging	0.96
R1959:Anapc1	UTSW	2	128,475,335 (GRCm39)	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128,511,608 (GRCm39)	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128,490,378 (GRCm39)	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128,484,468 (GRCm39)	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128,522,057 (GRCm39)	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128,484,602 (GRCm39)	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128,484,439 (GRCm39)	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128,469,149 (GRCm39)	intron	probably benign
R4359:Anapc1	UTSW	2	128,465,476 (GRCm39)	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128,518,169 (GRCm39)	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128,469,115 (GRCm39)	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128,505,925 (GRCm39)	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128,527,980 (GRCm39)	splice site	probably benign
R4824:Anapc1	UTSW	2	128,470,610 (GRCm39)	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128,526,514 (GRCm39)	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128,449,095 (GRCm39)	unclassified	probably benign
R5063:Anapc1	UTSW	2	128,471,469 (GRCm39)	missense	possibly damaging	0.48
R5128:Anapc1	UTSW	2	128,501,837 (GRCm39)	missense	probably benign
R5271:Anapc1	UTSW	2	128,527,905 (GRCm39)	nonsense	probably null
R5363:Anapc1	UTSW	2	128,492,114 (GRCm39)	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128,517,621 (GRCm39)	nonsense	probably null
R5473:Anapc1	UTSW	2	128,449,115 (GRCm39)	unclassified	probably benign
R5559:Anapc1	UTSW	2	128,522,354 (GRCm39)	nonsense	probably null
R5631:Anapc1	UTSW	2	128,499,137 (GRCm39)	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128,466,836 (GRCm39)	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128,448,957 (GRCm39)	unclassified	probably benign
R6226:Anapc1	UTSW	2	128,492,292 (GRCm39)	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128,514,055 (GRCm39)	nonsense	probably null
R6561:Anapc1	UTSW	2	128,505,919 (GRCm39)	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128,526,454 (GRCm39)	nonsense	probably null
R6799:Anapc1	UTSW	2	128,501,657 (GRCm39)	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128,501,688 (GRCm39)	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128,511,820 (GRCm39)	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128,490,601 (GRCm39)	splice site	probably null
R7041:Anapc1	UTSW	2	128,470,576 (GRCm39)	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128,457,350 (GRCm39)	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128,520,194 (GRCm39)	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128,516,522 (GRCm39)	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128,454,930 (GRCm39)	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128,516,604 (GRCm39)	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128,483,457 (GRCm39)	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128,526,528 (GRCm39)	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128,511,828 (GRCm39)	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128,516,513 (GRCm39)	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128,490,408 (GRCm39)	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128,474,547 (GRCm39)	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128,461,837 (GRCm39)	nonsense	probably null
R8402:Anapc1	UTSW	2	128,472,148 (GRCm39)	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128,517,757 (GRCm39)	missense	probably benign
R8425:Anapc1	UTSW	2	128,511,788 (GRCm39)	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128,500,264 (GRCm39)	splice site	probably null
R8553:Anapc1	UTSW	2	128,461,833 (GRCm39)	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128,527,748 (GRCm39)	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128,483,373 (GRCm39)	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128,483,369 (GRCm39)	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128,499,093 (GRCm39)	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128,499,093 (GRCm39)	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128,464,333 (GRCm39)	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128,505,952 (GRCm39)	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128,483,322 (GRCm39)	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128,476,628 (GRCm39)	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128,464,426 (GRCm39)	missense	possibly damaging	0.82
R9203:Anapc1	UTSW	2	128,465,422 (GRCm39)	missense	possibly damaging	0.66
R9314:Anapc1	UTSW	2	128,464,420 (GRCm39)	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128,459,642 (GRCm39)	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128,476,598 (GRCm39)	missense	probably benign
R9436:Anapc1	UTSW	2	128,518,045 (GRCm39)	missense	probably benign
R9516:Anapc1	UTSW	2	128,517,633 (GRCm39)	missense	possibly damaging	0.77
R9563:Anapc1	UTSW	2	128,505,980 (GRCm39)	nonsense	probably null
R9572:Anapc1	UTSW	2	128,505,976 (GRCm39)	missense	probably benign
R9757:Anapc1	UTSW	2	128,517,676 (GRCm39)	missense	probably damaging	1.00
R9766:Anapc1	UTSW	2	128,500,221 (GRCm39)	missense	probably damaging	1.00
X0066:Anapc1	UTSW	2	128,516,621 (GRCm39)	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- CACCATACCTTGTAGCCACTGGTC -3'
(R):5'- GCCCTCATGTTGAAGAAAGTGAGCC -3'

Sequencing Primer
(F):5'- TGGTCCAGGGTAGCATCAAC -3'
(R):5'- GAGGGCTCCTTAGTGTAGTCAAC -3'

Posted On

2013-11-07