Incidental Mutation 'R0919:Kpna4'
ID81574
Institutional Source Beutler Lab
Gene Symbol Kpna4
Ensembl Gene ENSMUSG00000027782
Gene Namekaryopherin (importin) alpha 4
Synonyms1110058D08Rik, IPOA3
MMRRC Submission 039069-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0919 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location69067149-69127113 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 69085828 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029353] [ENSMUST00000194558]
Predicted Effect probably benign
Transcript: ENSMUST00000029353
SMART Domains Protein: ENSMUSP00000029353
Gene: ENSMUSG00000027782

DomainStartEndE-ValueType
Pfam:IBB 7 93 2.4e-25 PFAM
ARM 103 144 7.73e-11 SMART
ARM 146 186 3.81e-10 SMART
ARM 188 229 2.04e1 SMART
ARM 232 271 4.15e-2 SMART
ARM 273 313 4.69e-10 SMART
ARM 315 355 9.6e-7 SMART
ARM 357 397 1.85e-8 SMART
ARM 400 440 9.45e-6 SMART
Pfam:Arm_3 447 499 4.1e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158792
Predicted Effect probably benign
Transcript: ENSMUST00000194558
SMART Domains Protein: ENSMUSP00000141227
Gene: ENSMUSG00000027782

DomainStartEndE-ValueType
Pfam:IBB 3 94 2.2e-27 PFAM
ARM 103 144 7.73e-11 SMART
ARM 146 186 3.81e-10 SMART
ARM 188 229 2.04e1 SMART
ARM 232 271 4.15e-2 SMART
ARM 273 313 4.69e-10 SMART
ARM 315 355 9.6e-7 SMART
ARM 357 397 1.85e-8 SMART
ARM 400 440 9.45e-6 SMART
low complexity region 479 493 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear import of karyophilic proteins is directed by short amino acid sequences termed nuclear localization signals (NLSs). Karyopherins, or importins, are cytoplasmic proteins that recognize NLSs and dock NLS-containing proteins to the nuclear pore complex. The protein encoded by this gene shares the sequence similarity with Xenopus importin-alpha and Saccharomyces cerevisiae Srp1. This protein is found to interact with the NLSs of DNA helicase Q1 and SV40 T antigen. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik A G 4: 10,882,462 T124A probably benign Het
Alpk2 C A 18: 65,307,473 C283F probably benign Het
Anapc1 T C 2: 128,617,731 R1803G probably benign Het
Anapc4 T C 5: 52,855,637 V423A probably benign Het
Arfgef3 A G 10: 18,589,735 I2120T possibly damaging Het
Btaf1 T A 19: 36,990,743 H1109Q probably benign Het
Cfap70 G A 14: 20,404,164 P851S probably benign Het
Clcf1 T A 19: 4,222,198 L103Q probably damaging Het
Col11a2 T A 17: 34,059,150 V1032E possibly damaging Het
Cyp2c38 T G 19: 39,404,669 D318A probably benign Het
Dbpht2 A G 12: 74,299,000 noncoding transcript Het
Dhx34 A C 7: 16,201,958 V893G probably damaging Het
Fsip2 T A 2: 82,985,484 C3854S possibly damaging Het
Htr1a T C 13: 105,444,836 Y195H probably damaging Het
Insr A G 8: 3,158,769 S1231P probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Olfr1032 A G 2: 86,008,640 Y288C possibly damaging Het
Olfr607 A G 7: 103,460,812 I132T probably damaging Het
Olfr671 A T 7: 104,975,312 Y228* probably null Het
Osbpl7 G A 11: 97,056,101 R239H possibly damaging Het
Prkce G A 17: 86,630,160 V674I probably benign Het
Prkrip1 T C 5: 136,197,831 M52V possibly damaging Het
Sash1 A G 10: 8,730,079 M849T probably benign Het
Scaf8 T C 17: 3,197,120 L906S probably damaging Het
Sfmbt2 T C 2: 10,577,571 L676P probably benign Het
Sgsm1 C T 5: 113,258,842 V923I probably damaging Het
Slc38a3 A T 9: 107,655,959 L305Q probably damaging Het
Slc44a5 A G 3: 154,243,586 Y232C probably damaging Het
Spag17 A T 3: 100,071,943 probably benign Het
Synm T C 7: 67,735,347 I414V probably damaging Het
Tbc1d12 C T 19: 38,914,049 H551Y possibly damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Trpc7 C T 13: 56,822,649 probably benign Het
Trpm7 G A 2: 126,831,238 R532C probably damaging Het
Ttn T A 2: 76,946,742 K1485* probably null Het
Txn2 T C 15: 77,927,749 D69G probably damaging Het
U2af2 C T 7: 5,069,434 probably benign Het
Ubn1 T C 16: 5,064,391 Y239H probably damaging Het
Ubtf A G 11: 102,309,777 probably benign Het
Usp49 T A 17: 47,672,451 V127D probably benign Het
Washc2 C T 6: 116,208,264 R20W probably damaging Het
Zscan10 T C 17: 23,610,007 S476P probably damaging Het
Other mutations in Kpna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Kpna4 APN 3 69102257 splice site probably benign
IGL01642:Kpna4 APN 3 69085784 missense probably damaging 0.99
IGL02752:Kpna4 APN 3 69095530 nonsense probably null
R0702:Kpna4 UTSW 3 69084105 missense probably damaging 1.00
R0865:Kpna4 UTSW 3 69101417 missense probably damaging 1.00
R5135:Kpna4 UTSW 3 69092809 critical splice donor site probably null
R5955:Kpna4 UTSW 3 69089801 missense probably benign 0.05
R6008:Kpna4 UTSW 3 69126733 missense probably null 0.81
R7106:Kpna4 UTSW 3 69079464 nonsense probably null
R7153:Kpna4 UTSW 3 69089798 missense probably damaging 1.00
R7155:Kpna4 UTSW 3 69089933 missense probably damaging 1.00
R7456:Kpna4 UTSW 3 69092848 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGCCTCAGATGCACTCCAATATC -3'
(R):5'- ACCCTTTTATTGATGCCAGTTCTGTTGA -3'

Sequencing Primer
(F):5'- tgcttagtatgccaaaggctc -3'
(R):5'- GCCAGTTCTGTTGAAATAACTTAAGC -3'
Posted On2013-11-07