Incidental Mutation 'R0919:2610301B20Rik'
ID81578
Institutional Source Beutler Lab
Gene Symbol 2610301B20Rik
Ensembl Gene ENSMUSG00000059482
Gene NameRIKEN cDNA 2610301B20 gene
Synonyms
MMRRC Submission 039069-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R0919 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location10874498-10899425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10882462 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 124 (T124A)
Ref Sequence ENSEMBL: ENSMUSP00000103966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080517] [ENSMUST00000101504]
Predicted Effect probably benign
Transcript: ENSMUST00000080517
AA Change: T124A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000079361
Gene: ENSMUSG00000059482
AA Change: T124A

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
Pfam:RMP 64 209 4.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101504
AA Change: T124A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000103966
Gene: ENSMUSG00000059482
AA Change: T124A

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
Pfam:RMP 64 210 1.3e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156124
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed protein of unknown function. It has high levels of mRNA expression in the brain, heart, and retina and the protein co-localizes with polyglutamylated tubulin at the base of the primary cilium in human retinal pigment epithelial cells. Mutations in this gene have been associated with autosomal recessive cone-rod dystrophy (arCRD) and retinitis pigmentosa (arRP). [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C A 18: 65,307,473 C283F probably benign Het
Anapc1 T C 2: 128,617,731 R1803G probably benign Het
Anapc4 T C 5: 52,855,637 V423A probably benign Het
Arfgef3 A G 10: 18,589,735 I2120T possibly damaging Het
Btaf1 T A 19: 36,990,743 H1109Q probably benign Het
Cfap70 G A 14: 20,404,164 P851S probably benign Het
Clcf1 T A 19: 4,222,198 L103Q probably damaging Het
Col11a2 T A 17: 34,059,150 V1032E possibly damaging Het
Cyp2c38 T G 19: 39,404,669 D318A probably benign Het
Dbpht2 A G 12: 74,299,000 noncoding transcript Het
Dhx34 A C 7: 16,201,958 V893G probably damaging Het
Fsip2 T A 2: 82,985,484 C3854S possibly damaging Het
Htr1a T C 13: 105,444,836 Y195H probably damaging Het
Insr A G 8: 3,158,769 S1231P probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kpna4 A T 3: 69,085,828 probably benign Het
Olfr1032 A G 2: 86,008,640 Y288C possibly damaging Het
Olfr607 A G 7: 103,460,812 I132T probably damaging Het
Olfr671 A T 7: 104,975,312 Y228* probably null Het
Osbpl7 G A 11: 97,056,101 R239H possibly damaging Het
Prkce G A 17: 86,630,160 V674I probably benign Het
Prkrip1 T C 5: 136,197,831 M52V possibly damaging Het
Sash1 A G 10: 8,730,079 M849T probably benign Het
Scaf8 T C 17: 3,197,120 L906S probably damaging Het
Sfmbt2 T C 2: 10,577,571 L676P probably benign Het
Sgsm1 C T 5: 113,258,842 V923I probably damaging Het
Slc38a3 A T 9: 107,655,959 L305Q probably damaging Het
Slc44a5 A G 3: 154,243,586 Y232C probably damaging Het
Spag17 A T 3: 100,071,943 probably benign Het
Synm T C 7: 67,735,347 I414V probably damaging Het
Tbc1d12 C T 19: 38,914,049 H551Y possibly damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Trpc7 C T 13: 56,822,649 probably benign Het
Trpm7 G A 2: 126,831,238 R532C probably damaging Het
Ttn T A 2: 76,946,742 K1485* probably null Het
Txn2 T C 15: 77,927,749 D69G probably damaging Het
U2af2 C T 7: 5,069,434 probably benign Het
Ubn1 T C 16: 5,064,391 Y239H probably damaging Het
Ubtf A G 11: 102,309,777 probably benign Het
Usp49 T A 17: 47,672,451 V127D probably benign Het
Washc2 C T 6: 116,208,264 R20W probably damaging Het
Zscan10 T C 17: 23,610,007 S476P probably damaging Het
Other mutations in 2610301B20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02627:2610301B20Rik APN 4 10898039 missense probably damaging 1.00
R1695:2610301B20Rik UTSW 4 10874644 missense probably damaging 1.00
R3804:2610301B20Rik UTSW 4 10898014 missense probably benign 0.02
R6721:2610301B20Rik UTSW 4 10874744 missense probably benign 0.19
R7033:2610301B20Rik UTSW 4 10898014 missense probably benign 0.02
X0064:2610301B20Rik UTSW 4 10881832 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAGTGTTCCTGATGCAGGTGATATCC -3'
(R):5'- CAAGTGATTCAGGCCCTCCAAGTG -3'

Sequencing Primer
(F):5'- CCTGATGCAGGTGATATCCTATAGAG -3'
(R):5'- gtagccatcatccagccc -3'
Posted On2013-11-07