Incidental Mutation 'R0964:Lmo7'
ID81591
Institutional Source Beutler Lab
Gene Symbol Lmo7
Ensembl Gene ENSMUSG00000033060
Gene NameLIM domain only 7
SynonymsFBXO20, LOC380928
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R0964 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location101729957-101934710 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 101920567 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000100337] [ENSMUST00000159258] [ENSMUST00000159314] [ENSMUST00000159597]
Predicted Effect probably benign
Transcript: ENSMUST00000100337
SMART Domains Protein: ENSMUSP00000097910
Gene: ENSMUSG00000033060

DomainStartEndE-ValueType
CH 14 124 2.57e-13 SMART
low complexity region 200 211 N/A INTRINSIC
Pfam:DUF4757 242 348 2.2e-14 PFAM
low complexity region 448 462 N/A INTRINSIC
Pfam:DUF4757 568 735 1.8e-46 PFAM
low complexity region 861 879 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 1003 1015 N/A INTRINSIC
PDZ 1047 1119 1.05e-8 SMART
coiled coil region 1222 1275 N/A INTRINSIC
coiled coil region 1319 1411 N/A INTRINSIC
low complexity region 1585 1596 N/A INTRINSIC
low complexity region 1599 1617 N/A INTRINSIC
LIM 1629 1687 6.54e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159154
Predicted Effect probably benign
Transcript: ENSMUST00000159258
SMART Domains Protein: ENSMUSP00000125465
Gene: ENSMUSG00000033060

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159314
SMART Domains Protein: ENSMUSP00000124349
Gene: ENSMUSG00000033060

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
coiled coil region 435 492 N/A INTRINSIC
low complexity region 628 646 N/A INTRINSIC
low complexity region 746 758 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
PDZ 814 886 1.05e-8 SMART
coiled coil region 989 1042 N/A INTRINSIC
coiled coil region 1086 1178 N/A INTRINSIC
low complexity region 1352 1363 N/A INTRINSIC
low complexity region 1366 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159597
SMART Domains Protein: ENSMUSP00000123706
Gene: ENSMUSG00000033060

DomainStartEndE-ValueType
low complexity region 78 89 N/A INTRINSIC
internal_repeat_1 111 141 6.96e-5 PROSPERO
internal_repeat_1 218 248 6.96e-5 PROSPERO
low complexity region 326 340 N/A INTRINSIC
coiled coil region 546 603 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
PDZ 925 997 1.05e-8 SMART
coiled coil region 1127 1180 N/A INTRINSIC
coiled coil region 1224 1316 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1504 1522 N/A INTRINSIC
LIM 1534 1592 6.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159806
SMART Domains Protein: ENSMUSP00000124300
Gene: ENSMUSG00000033060

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
Pfam:DUF4757 76 225 4.5e-53 PFAM
low complexity region 351 369 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
PDZ 537 609 1.05e-8 SMART
internal_repeat_1 620 691 9.31e-5 PROSPERO
coiled coil region 711 764 N/A INTRINSIC
coiled coil region 808 900 N/A INTRINSIC
internal_repeat_1 921 976 9.31e-5 PROSPERO
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1089 1107 N/A INTRINSIC
LIM 1119 1177 6.54e-10 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a calponin homology (CH) domain, a PDZ domain, and a LIM domain, and may be involved in protein-protein interactions. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene, however, the full-length nature of some variants is not known. [provided by RefSeq, Jan 2009]
PHENOTYPE: Targeted mutations in this gene result in postnatal lethality, growth defects, skeletal muscle abnormalities and retinal defects reflective of retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Alppl2 C T 1: 87,087,724 V372I possibly damaging Het
Apol8 C T 15: 77,749,611 S255N probably benign Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Bbs4 A G 9: 59,322,976 *150Q probably null Het
Cacna1h A T 17: 25,378,775 probably benign Het
Ccser2 C T 14: 36,909,008 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Col20a1 T A 2: 180,984,485 probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gckr T C 5: 31,326,915 probably benign Het
Gpbp1l1 A G 4: 116,581,239 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr460 T C 6: 40,572,205 V273A probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Prodh2 C A 7: 30,506,281 R218S probably damaging Het
Rps15a T C 7: 118,114,837 D54G probably benign Het
Sbno2 G T 10: 80,084,259 T46N possibly damaging Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Uhrf1bp1 A T 17: 27,887,178 T893S probably damaging Het
Vmn2r106 G A 17: 20,267,597 H847Y probably benign Het
Vmn2r15 T C 5: 109,297,535 T8A probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb41 T G 1: 139,439,031 F583V probably damaging Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in Lmo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Lmo7 APN 14 101887051 missense probably damaging 0.99
IGL00733:Lmo7 APN 14 101915702 missense probably damaging 1.00
IGL00778:Lmo7 APN 14 101910885 splice site probably benign
IGL01014:Lmo7 APN 14 101920557 splice site probably benign
IGL01401:Lmo7 APN 14 101794277 nonsense probably null
IGL01550:Lmo7 APN 14 101926140 utr 3 prime probably benign
IGL01570:Lmo7 APN 14 101902371 critical splice donor site probably null
IGL01602:Lmo7 APN 14 101910756 splice site probably benign
IGL01605:Lmo7 APN 14 101910756 splice site probably benign
IGL02012:Lmo7 APN 14 101888716 intron probably benign
IGL02145:Lmo7 APN 14 101902223 missense probably benign 0.00
IGL02236:Lmo7 APN 14 101926088 splice site probably benign
IGL02318:Lmo7 APN 14 101900066 splice site probably benign
IGL02345:Lmo7 APN 14 101887473 missense probably damaging 1.00
IGL02498:Lmo7 APN 14 101807482 missense probably benign 0.01
IGL02583:Lmo7 APN 14 101933924 utr 3 prime probably benign
IGL02670:Lmo7 APN 14 101880980 missense probably damaging 1.00
IGL02694:Lmo7 APN 14 101887170 missense probably damaging 1.00
IGL03026:Lmo7 APN 14 101929333 utr 3 prime probably benign
IGL03062:Lmo7 APN 14 101912079 missense possibly damaging 0.66
IGL03068:Lmo7 APN 14 101875492 unclassified probably benign
IGL03178:Lmo7 APN 14 101929260 nonsense probably null
IGL03279:Lmo7 APN 14 101900508 missense probably benign 0.30
PIT4458001:Lmo7 UTSW 14 101887487 nonsense probably null
R0029:Lmo7 UTSW 14 101933921 utr 3 prime probably benign
R0112:Lmo7 UTSW 14 101887193 nonsense probably null
R0345:Lmo7 UTSW 14 101876877 missense probably damaging 1.00
R0372:Lmo7 UTSW 14 101918053 splice site probably benign
R0393:Lmo7 UTSW 14 101900456 missense probably benign
R0514:Lmo7 UTSW 14 101887173 missense probably damaging 1.00
R0514:Lmo7 UTSW 14 101896559 missense probably damaging 1.00
R0526:Lmo7 UTSW 14 101900560 missense probably damaging 1.00
R0615:Lmo7 UTSW 14 101876859 nonsense probably null
R0900:Lmo7 UTSW 14 101887188 missense probably damaging 1.00
R0961:Lmo7 UTSW 14 101794269 missense probably benign 0.00
R1078:Lmo7 UTSW 14 101920474 splice site probably benign
R1252:Lmo7 UTSW 14 101900583 missense probably damaging 1.00
R1527:Lmo7 UTSW 14 101876828 missense probably damaging 1.00
R1537:Lmo7 UTSW 14 101929264 utr 3 prime probably benign
R1565:Lmo7 UTSW 14 101887521 missense probably damaging 0.99
R1637:Lmo7 UTSW 14 101880832 missense probably damaging 1.00
R1943:Lmo7 UTSW 14 101902302 missense probably damaging 1.00
R1967:Lmo7 UTSW 14 101900215 missense probably benign 0.36
R2002:Lmo7 UTSW 14 101887061 missense probably benign 0.13
R2057:Lmo7 UTSW 14 101887178 missense probably damaging 1.00
R2131:Lmo7 UTSW 14 101900238 missense probably damaging 0.99
R2153:Lmo7 UTSW 14 101920515 utr 3 prime probably benign
R2257:Lmo7 UTSW 14 101900130 missense probably damaging 1.00
R2355:Lmo7 UTSW 14 101888685 missense probably damaging 1.00
R2356:Lmo7 UTSW 14 101886945 missense probably damaging 1.00
R2898:Lmo7 UTSW 14 101876914 missense possibly damaging 0.93
R3847:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3848:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3849:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3916:Lmo7 UTSW 14 101929342 utr 3 prime probably benign
R4050:Lmo7 UTSW 14 101902277 nonsense probably null
R4326:Lmo7 UTSW 14 101900074 missense possibly damaging 0.93
R4357:Lmo7 UTSW 14 101887655 missense probably null 1.00
R4571:Lmo7 UTSW 14 101887594 missense probably damaging 0.96
R4658:Lmo7 UTSW 14 101886957 missense probably damaging 1.00
R4857:Lmo7 UTSW 14 101887348 intron probably null
R5006:Lmo7 UTSW 14 101926237 utr 3 prime probably benign
R5528:Lmo7 UTSW 14 101902086 missense probably damaging 1.00
R5588:Lmo7 UTSW 14 101896590 splice site probably null
R5643:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R5644:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R5650:Lmo7 UTSW 14 101898674 missense probably damaging 1.00
R5737:Lmo7 UTSW 14 101887236 missense probably damaging 1.00
R5832:Lmo7 UTSW 14 101884213 missense probably damaging 1.00
R5966:Lmo7 UTSW 14 101900502 missense possibly damaging 0.92
R6026:Lmo7 UTSW 14 101880990 missense probably benign 0.04
R6072:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R6158:Lmo7 UTSW 14 101900137 missense probably benign 0.03
R6246:Lmo7 UTSW 14 101918700 missense probably damaging 1.00
R6335:Lmo7 UTSW 14 101900636 missense probably damaging 1.00
R6620:Lmo7 UTSW 14 101875452 missense probably benign 0.29
R6658:Lmo7 UTSW 14 101910845 missense possibly damaging 0.84
R6917:Lmo7 UTSW 14 101918010 missense probably damaging 1.00
R7064:Lmo7 UTSW 14 101884179 missense probably damaging 1.00
R7072:Lmo7 UTSW 14 101898700 critical splice donor site probably null
R7121:Lmo7 UTSW 14 101887035 missense probably damaging 1.00
R7136:Lmo7 UTSW 14 101920539 missense unknown
R7196:Lmo7 UTSW 14 101896500 missense possibly damaging 0.75
R7228:Lmo7 UTSW 14 101896535 missense probably damaging 0.99
R7337:Lmo7 UTSW 14 101884204 missense probably damaging 0.98
R7341:Lmo7 UTSW 14 101885512 missense probably benign 0.30
R7408:Lmo7 UTSW 14 101880953 missense probably damaging 1.00
R7432:Lmo7 UTSW 14 101902115 missense probably benign 0.42
R7470:Lmo7 UTSW 14 101900604 missense possibly damaging 0.83
R7506:Lmo7 UTSW 14 101919609 missense unknown
R7559:Lmo7 UTSW 14 101887226 nonsense probably null
R7565:Lmo7 UTSW 14 101885301 missense probably damaging 0.98
X0066:Lmo7 UTSW 14 101887461 missense probably damaging 1.00
X0067:Lmo7 UTSW 14 101886933 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGTGGACGTGAGATTAGCAAATGCC -3'
(R):5'- ACAGGATGCTGAAGACTGCTGCTC -3'

Sequencing Primer
(F):5'- CGTGAGATTAGCAAATGCCTATAGC -3'
(R):5'- gctcagaatgctgacccac -3'
Posted On2013-11-08