Incidental Mutation 'R0964:Apol8'
ID81592
Institutional Source Beutler Lab
Gene Symbol Apol8
Ensembl Gene ENSMUSG00000056656
Gene Nameapolipoprotein L 8
SynonymsApol2, 9830006J20Rik
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0964 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location77747798-77757003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 77749611 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 255 (S255N)
Ref Sequence ENSEMBL: ENSMUSP00000086873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070911] [ENSMUST00000089450] [ENSMUST00000229332] [ENSMUST00000229445]
Predicted Effect probably benign
Transcript: ENSMUST00000070911
AA Change: S255N

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064237
Gene: ENSMUSG00000056656
AA Change: S255N

DomainStartEndE-ValueType
Pfam:ApoL 26 333 2.5e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089450
AA Change: S255N

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000086873
Gene: ENSMUSG00000056656
AA Change: S255N

DomainStartEndE-ValueType
Pfam:ApoL 1 307 9.4e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229332
Predicted Effect probably benign
Transcript: ENSMUST00000229445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230332
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the apolipoprotein L gene family. The encoded protein is found in the cytoplasm, where it may affect the movement of lipids or allow the binding of lipids to organelles. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Alppl2 C T 1: 87,087,724 V372I possibly damaging Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Bbs4 A G 9: 59,322,976 *150Q probably null Het
Cacna1h A T 17: 25,378,775 probably benign Het
Ccser2 C T 14: 36,909,008 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Col20a1 T A 2: 180,984,485 probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gckr T C 5: 31,326,915 probably benign Het
Gpbp1l1 A G 4: 116,581,239 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Lmo7 T C 14: 101,920,567 probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr460 T C 6: 40,572,205 V273A probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Prodh2 C A 7: 30,506,281 R218S probably damaging Het
Rps15a T C 7: 118,114,837 D54G probably benign Het
Sbno2 G T 10: 80,084,259 T46N possibly damaging Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Uhrf1bp1 A T 17: 27,887,178 T893S probably damaging Het
Vmn2r106 G A 17: 20,267,597 H847Y probably benign Het
Vmn2r15 T C 5: 109,297,535 T8A probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb41 T G 1: 139,439,031 F583V probably damaging Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in Apol8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Apol8 APN 15 77750014 missense probably damaging 1.00
IGL00569:Apol8 APN 15 77750055 missense probably benign 0.01
IGL01955:Apol8 APN 15 77749699 missense probably benign 0.01
R0677:Apol8 UTSW 15 77749851 missense probably damaging 1.00
R1720:Apol8 UTSW 15 77749366 missense possibly damaging 0.93
R3508:Apol8 UTSW 15 77749443 missense probably damaging 0.97
R6465:Apol8 UTSW 15 77749948 missense probably benign 0.21
R6771:Apol8 UTSW 15 77753058 intron probably null
Predicted Primers PCR Primer
(F):5'- GCCTGCCTGCAAACCTTCATACATC -3'
(R):5'- GGTCATTAGCCAAAACGGAAGCCAG -3'

Sequencing Primer
(F):5'- GATGAGCGCCTCCAGTTTC -3'
(R):5'- CAGCCACCTGGTGTCAAC -3'
Posted On2013-11-08