Incidental Mutation 'R0965:Bcl2'
ID 81602
Institutional Source Beutler Lab
Gene Symbol Bcl2
Ensembl Gene ENSMUSG00000057329
Gene Name B cell leukemia/lymphoma 2
Synonyms Bcl-2, C430015F12Rik, D830018M01Rik
MMRRC Submission 039094-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.910) question?
Stock # R0965 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 106465908-106642004 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106640021 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 197 (L197Q)
Ref Sequence ENSEMBL: ENSMUSP00000139856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112751] [ENSMUST00000189999]
AlphaFold P10417
Predicted Effect probably benign
Transcript: ENSMUST00000112751
SMART Domains Protein: ENSMUSP00000108371
Gene: ENSMUSG00000057329

DomainStartEndE-ValueType
BH4 7 33 1.13e-12 SMART
BCL 94 192 4.43e-48 SMART
transmembrane domain 211 233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189999
AA Change: L197Q

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139856
Gene: ENSMUSG00000057329
AA Change: L197Q

DomainStartEndE-ValueType
BH4 7 33 1.13e-12 SMART
BCL 94 192 4.43e-48 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the B cell lymphoma 2 protein family. Members of this family regulate cell death in multiple cell types and can have either proapoptotic or antiapoptotic activities. The protein encoded by this gene inhibits mitochondrial-mediated apoptosis. This protein is an integral outer mitochondrial membrane protein that functions as part of signaling pathway that controls mitochondrial permeability in response to apoptotic stimuli. This protein may also play a role in neuron cell survival and autophagy. Abnormal expression and chromosomal translocations of this gene are associated with cancer progression in numerous tissues. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants show pleiotropic abnormalities including small size, increased postnatal mortality, polycystic kidneys, apoptotic involution of thymus and spleen, graying in the second hair follicle cycle, and reduced numbers of motor, sympathetic and sensory neurons. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(8) Gene trapped(2) Chemically induced(1)          

Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG 4: 129,886,209 (GRCm39) probably benign Het
Amacr C T 15: 10,984,891 (GRCm39) R170C probably damaging Het
Brd1 G A 15: 88,601,231 (GRCm39) R468W probably damaging Het
Esco1 A G 18: 10,567,570 (GRCm39) F821L probably damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Gzma G A 13: 113,234,868 (GRCm39) P38L probably damaging Het
Mcc A G 18: 44,857,593 (GRCm39) L174P probably benign Het
Med19 A G 2: 84,508,793 (GRCm39) E2G probably damaging Het
Muc5b C T 7: 141,417,539 (GRCm39) T3495I possibly damaging Het
Nfatc4 T C 14: 56,064,043 (GRCm39) S107P probably damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or9g4b A G 2: 85,616,643 (GRCm39) S263G probably damaging Het
Phf11c T A 14: 59,618,931 (GRCm39) I285F probably damaging Het
Prkdc T C 16: 15,647,580 (GRCm39) V3668A probably benign Het
Rbm20 T C 19: 53,847,832 (GRCm39) F1126S probably damaging Het
Slc7a5 T C 8: 122,633,840 (GRCm39) E169G probably benign Het
Slco1b2 C A 6: 141,631,322 (GRCm39) T652K probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Tmem119 A C 5: 113,933,480 (GRCm39) V107G probably damaging Het
Ttn C A 2: 76,629,915 (GRCm39) G14205V probably damaging Het
Zc3h11a T C 1: 133,573,541 (GRCm39) N33S possibly damaging Het
Other mutations in Bcl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Bcl2 APN 1 106,640,088 (GRCm39) missense possibly damaging 0.95
IGL03076:Bcl2 APN 1 106,471,037 (GRCm39) missense probably benign 0.24
Croce UTSW 1 106,471,011 (GRCm39) missense probably damaging 1.00
R0002:Bcl2 UTSW 1 106,640,241 (GRCm39) missense possibly damaging 0.94
R0002:Bcl2 UTSW 1 106,640,241 (GRCm39) missense possibly damaging 0.94
R0083:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0086:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0107:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0183:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0217:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0219:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0346:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0347:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0348:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0361:Bcl2 UTSW 1 106,640,424 (GRCm39) missense probably damaging 0.96
R0470:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0471:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0601:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0609:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R1756:Bcl2 UTSW 1 106,640,122 (GRCm39) missense probably damaging 1.00
R2764:Bcl2 UTSW 1 106,640,166 (GRCm39) missense probably damaging 1.00
R4798:Bcl2 UTSW 1 106,640,338 (GRCm39) missense possibly damaging 0.57
R4922:Bcl2 UTSW 1 106,640,376 (GRCm39) missense probably benign 0.00
R6864:Bcl2 UTSW 1 106,471,011 (GRCm39) missense probably damaging 1.00
R7576:Bcl2 UTSW 1 106,640,153 (GRCm39) missense possibly damaging 0.64
R7837:Bcl2 UTSW 1 106,471,086 (GRCm39) missense possibly damaging 0.93
R8176:Bcl2 UTSW 1 106,640,528 (GRCm39) missense probably damaging 1.00
R9486:Bcl2 UTSW 1 106,471,109 (GRCm39) missense probably benign 0.40
R9548:Bcl2 UTSW 1 106,640,508 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTGCTTACACAGGACCCAGAAC -3'
(R):5'- GACTTCGCAGAGATGTCCAGTCAG -3'

Sequencing Primer
(F):5'- CCTACTGGATCAAAAATGCTGG -3'
(R):5'- CTCTTCAGGGATGGGGTGAAC -3'
Posted On 2013-11-08