Incidental Mutation 'R0870:Rasip1'
ID81628
Institutional Source Beutler Lab
Gene Symbol Rasip1
Ensembl Gene ENSMUSG00000044562
Gene NameRas interacting protein 1
SynonymsRain, 2610025P08Rik
MMRRC Submission 039042-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0870 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45627488-45639093 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45635028 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 639 (P639S)
Ref Sequence ENSEMBL: ENSMUSP00000062429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057927] [ENSMUST00000148532]
Predicted Effect probably damaging
Transcript: ENSMUST00000057927
AA Change: P639S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062429
Gene: ENSMUSG00000044562
AA Change: P639S

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 59 67 N/A INTRINSIC
low complexity region 72 90 N/A INTRINSIC
low complexity region 97 112 N/A INTRINSIC
RA 141 253 6.94e-8 SMART
low complexity region 284 308 N/A INTRINSIC
low complexity region 310 326 N/A INTRINSIC
low complexity region 327 339 N/A INTRINSIC
SCOP:d1gxca_ 391 484 1e-2 SMART
low complexity region 498 509 N/A INTRINSIC
low complexity region 556 575 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
DIL 768 877 4.14e-44 SMART
low complexity region 928 947 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148532
SMART Domains Protein: ENSMUSP00000114686
Gene: ENSMUSG00000042918

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
SAP 165 199 1.3e-7 SMART
low complexity region 200 213 N/A INTRINSIC
low complexity region 255 297 N/A INTRINSIC
low complexity region 320 336 N/A INTRINSIC
low complexity region 347 372 N/A INTRINSIC
low complexity region 385 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211533
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation exhibit complete embryonic lethality during organogenesis associated with a failure in cardiovascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 5 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Fat2 A T 11: 55,311,775 S158T probably benign Het
Pum1 A G 4: 130,768,844 H963R probably damaging Het
Thsd7a A G 6: 12,337,274 V1248A probably damaging Het
Other mutations in Rasip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Rasip1 APN 7 45636764 nonsense probably null
IGL01995:Rasip1 APN 7 45636816 missense probably damaging 0.99
R0208:Rasip1 UTSW 7 45632575 missense probably damaging 0.97
R0373:Rasip1 UTSW 7 45635244 missense possibly damaging 0.50
R0869:Rasip1 UTSW 7 45635028 missense probably damaging 0.99
R0871:Rasip1 UTSW 7 45635028 missense probably damaging 0.99
R0872:Rasip1 UTSW 7 45635028 missense probably damaging 0.99
R1388:Rasip1 UTSW 7 45630232 missense probably damaging 0.98
R1780:Rasip1 UTSW 7 45635318 missense possibly damaging 0.94
R2348:Rasip1 UTSW 7 45629083 critical splice donor site probably null
R2517:Rasip1 UTSW 7 45634823 missense probably damaging 1.00
R4587:Rasip1 UTSW 7 45632735 missense possibly damaging 0.86
R4678:Rasip1 UTSW 7 45627823 missense possibly damaging 0.86
R4679:Rasip1 UTSW 7 45627823 missense possibly damaging 0.86
R4714:Rasip1 UTSW 7 45632396 frame shift probably null
R5572:Rasip1 UTSW 7 45636729 missense probably benign 0.00
R6182:Rasip1 UTSW 7 45628455 small deletion probably benign
R7443:Rasip1 UTSW 7 45638724 missense probably damaging 1.00
X0018:Rasip1 UTSW 7 45638868 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGAAATTGGAGACCGCCAGCC -3'
(R):5'- GTATTTCAGGAGGGAAGCGTCACC -3'

Sequencing Primer
(F):5'- CCGCCAGCCAGAGAAGTAAG -3'
(R):5'- TCCAAGTCATTGCAGAGCTG -3'
Posted On2013-11-08