Incidental Mutation 'R0947:Pbx1'
ID81646
Institutional Source Beutler Lab
Gene Symbol Pbx1
Ensembl Gene ENSMUSG00000052534
Gene Namepre B cell leukemia homeobox 1
SynonymsPbx1b, Pbx1a, D230003C07Rik, Pbx-1, 2310056B04Rik
MMRRC Submission 039086-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0947 (G1)
Quality Score163
Status Not validated
Chromosome1
Chromosomal Location168119364-168432270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 168203366 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 228 (S228P)
Ref Sequence ENSEMBL: ENSMUSP00000066385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064438] [ENSMUST00000072863] [ENSMUST00000176540] [ENSMUST00000176790] [ENSMUST00000188912]
Predicted Effect probably damaging
Transcript: ENSMUST00000064438
AA Change: S228P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066385
Gene: ENSMUSG00000052534
AA Change: S228P

DomainStartEndE-ValueType
Pfam:PBC 35 232 2e-106 PFAM
HOX 233 290 5.15e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000072863
AA Change: S228P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072640
Gene: ENSMUSG00000052534
AA Change: S228P

DomainStartEndE-ValueType
Pfam:PBC 35 232 2.1e-106 PFAM
HOX 233 298 6.17e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176482
Predicted Effect probably damaging
Transcript: ENSMUST00000176540
AA Change: S228P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135516
Gene: ENSMUSG00000052534
AA Change: S228P

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:PBC 40 232 6.9e-98 PFAM
HOX 233 298 6.17e-18 SMART
low complexity region 323 344 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176790
AA Change: S228P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134925
Gene: ENSMUSG00000052534
AA Change: S228P

DomainStartEndE-ValueType
Pfam:PBC 35 232 2.1e-106 PFAM
HOX 233 298 6.17e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188912
AA Change: S228P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140606
Gene: ENSMUSG00000052534
AA Change: S228P

DomainStartEndE-ValueType
Pfam:PBC 35 232 2.1e-106 PFAM
HOX 233 298 6.17e-18 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.2%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homeobox protein that belongs to the three-amino-acid loop extension/Pre-B cell leukemia transcription factor (TALE/PBX) family of proteins. The encoded protein is involved in several biological processes during embryogenesis including steroidogenesis, sexual development and the maintenance of hematopoietic stem cells. This protein functions in the development of several organ systems and plays a role in skeletal patterning and programming. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous disruption of this gene causes late gestational death, hypoplasia/aplasia of many organs, impaired hematopoiesis, anemia, skin edema, axial and appendicular skeleton defects, absent adrenal glands, abnormal chondrocyte differentiation, and abnormal bone, kidney and pancreas development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh7a1 A T 18: 56,560,838 probably null Het
Atm A G 9: 53,504,092 V833A probably benign Het
Atp6v1b1 A T 6: 83,753,832 I180F probably damaging Het
Cwf19l2 T C 9: 3,421,286 S188P probably benign Het
Gdpd1 T G 11: 87,037,881 E240D probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Htt T C 5: 34,898,924 S2681P probably damaging Het
Itgad A G 7: 128,175,693 D40G probably benign Het
Krt18 A G 15: 102,030,728 Y249C possibly damaging Het
Lrp2 G T 2: 69,487,838 P2090T probably damaging Het
Lrrc32 A G 7: 98,498,883 D290G probably benign Het
Man1a A T 10: 53,933,523 Y486* probably null Het
Mcm9 CCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCC CCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCC 10: 53,537,501 probably benign Het
Nin A T 12: 70,061,186 C211S probably damaging Het
Npat A C 9: 53,570,324 I1111L probably benign Het
Olfr1505 T A 19: 13,919,171 H50Q probably benign Het
Olfr507 A G 7: 108,622,672 I287V probably benign Het
Pcsk7 G T 9: 45,911,172 R230L probably damaging Het
Prom2 G T 2: 127,538,263 Q350K possibly damaging Het
Racgap1 C T 15: 99,624,314 A458T possibly damaging Het
Rsf1 T A 7: 97,669,778 C912S probably damaging Het
Setd2 G A 9: 110,548,511 E465K possibly damaging Het
Sgk2 T A 2: 163,006,838 D269E probably benign Het
Spsb1 T C 4: 149,907,079 T11A probably benign Het
Tln2 A T 9: 67,295,813 S509T probably benign Het
Trim5 A T 7: 104,265,751 D370E probably damaging Het
Ttn T A 2: 76,885,230 probably benign Het
Ubr2 C A 17: 46,941,112 G1501C probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r93 A T 17: 18,304,081 R112S probably benign Het
Vps26b T C 9: 27,012,781 Y222C probably damaging Het
Wdr64 T A 1: 175,775,749 Y198N probably benign Het
Xrn1 A T 9: 95,998,263 K752I possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp386 T C 12: 116,059,778 I372T probably benign Het
Zfp804a T C 2: 82,258,718 Y964H possibly damaging Het
Other mutations in Pbx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Pbx1 APN 1 168191304 missense probably benign 0.00
IGL02256:Pbx1 APN 1 168183602 missense possibly damaging 0.88
IGL03040:Pbx1 APN 1 168427946 splice site probably benign
root_cause UTSW 1 168209534 missense probably damaging 1.00
R0240:Pbx1 UTSW 1 168203482 missense possibly damaging 0.88
R0240:Pbx1 UTSW 1 168203482 missense possibly damaging 0.88
R1785:Pbx1 UTSW 1 168431378 missense probably benign 0.09
R1893:Pbx1 UTSW 1 168203410 missense possibly damaging 0.91
R3552:Pbx1 UTSW 1 168158793 missense possibly damaging 0.88
R4176:Pbx1 UTSW 1 168191272 splice site probably null
R4757:Pbx1 UTSW 1 168195881 missense probably damaging 1.00
R5024:Pbx1 UTSW 1 168183589 missense possibly damaging 0.93
R6102:Pbx1 UTSW 1 168183565 missense probably benign 0.05
R6296:Pbx1 UTSW 1 168183615 missense possibly damaging 0.71
R6302:Pbx1 UTSW 1 168191341 missense probably benign
R6488:Pbx1 UTSW 1 168191395 missense probably damaging 1.00
R6501:Pbx1 UTSW 1 168209534 missense probably damaging 1.00
R7014:Pbx1 UTSW 1 168431380 missense probably damaging 0.98
R7070:Pbx1 UTSW 1 168195768 missense probably damaging 0.98
X0024:Pbx1 UTSW 1 168431365 nonsense probably null
X0027:Pbx1 UTSW 1 168183612 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GAAACCAACAGGCTATCCTGTCTCC -3'
(R):5'- GCACTTGAAGCCAGTGCCAAAC -3'

Sequencing Primer
(F):5'- GTGTTTCTCGGACCTTAGACC -3'
(R):5'- GCCAAGCCAGATATTTCAGTTC -3'
Posted On2013-11-08