Incidental Mutation 'R0947:Sgk2'
ID81652
Institutional Source Beutler Lab
Gene Symbol Sgk2
Ensembl Gene ENSMUSG00000017868
Gene Nameserum/glucocorticoid regulated kinase 2
Synonyms
MMRRC Submission 039086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R0947 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location162987330-163014127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 163006838 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 269 (D269E)
Ref Sequence ENSEMBL: ENSMUSP00000112468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018012] [ENSMUST00000117123]
Predicted Effect probably benign
Transcript: ENSMUST00000018012
AA Change: D298E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000018012
Gene: ENSMUSG00000017868
AA Change: D298E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
S_TKc 35 292 4.09e-102 SMART
S_TK_X 293 359 8.21e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117123
AA Change: D269E

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112468
Gene: ENSMUSG00000017868
AA Change: D269E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
S_TKc 35 263 2.24e-76 SMART
S_TK_X 264 330 8.21e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139053
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.2%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase. Although this gene product is similar to serum- and glucocorticoid-induced protein kinase (SGK), this gene is not induced by serum or glucocorticoids. This gene is induced in response to signals that activate phosphatidylinositol 3-kinase, which is also true for SGK. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh7a1 A T 18: 56,560,838 probably null Het
Atm A G 9: 53,504,092 V833A probably benign Het
Atp6v1b1 A T 6: 83,753,832 I180F probably damaging Het
Cwf19l2 T C 9: 3,421,286 S188P probably benign Het
Gdpd1 T G 11: 87,037,881 E240D probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Htt T C 5: 34,898,924 S2681P probably damaging Het
Itgad A G 7: 128,175,693 D40G probably benign Het
Krt18 A G 15: 102,030,728 Y249C possibly damaging Het
Lrp2 G T 2: 69,487,838 P2090T probably damaging Het
Lrrc32 A G 7: 98,498,883 D290G probably benign Het
Man1a A T 10: 53,933,523 Y486* probably null Het
Mcm9 CCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCC CCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCC 10: 53,537,501 probably benign Het
Nin A T 12: 70,061,186 C211S probably damaging Het
Npat A C 9: 53,570,324 I1111L probably benign Het
Olfr1505 T A 19: 13,919,171 H50Q probably benign Het
Olfr507 A G 7: 108,622,672 I287V probably benign Het
Pbx1 A G 1: 168,203,366 S228P probably damaging Het
Pcsk7 G T 9: 45,911,172 R230L probably damaging Het
Prom2 G T 2: 127,538,263 Q350K possibly damaging Het
Racgap1 C T 15: 99,624,314 A458T possibly damaging Het
Rsf1 T A 7: 97,669,778 C912S probably damaging Het
Setd2 G A 9: 110,548,511 E465K possibly damaging Het
Spsb1 T C 4: 149,907,079 T11A probably benign Het
Tln2 A T 9: 67,295,813 S509T probably benign Het
Trim5 A T 7: 104,265,751 D370E probably damaging Het
Ttn T A 2: 76,885,230 probably benign Het
Ubr2 C A 17: 46,941,112 G1501C probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r93 A T 17: 18,304,081 R112S probably benign Het
Vps26b T C 9: 27,012,781 Y222C probably damaging Het
Wdr64 T A 1: 175,775,749 Y198N probably benign Het
Xrn1 A T 9: 95,998,263 K752I possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp386 T C 12: 116,059,778 I372T probably benign Het
Zfp804a T C 2: 82,258,718 Y964H possibly damaging Het
Other mutations in Sgk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03048:Sgk2 UTSW 2 162995760 missense probably damaging 1.00
R0319:Sgk2 UTSW 2 162995672 splice site probably benign
R0563:Sgk2 UTSW 2 163004244 missense probably damaging 1.00
R1624:Sgk2 UTSW 2 162997859 missense probably benign 0.20
R1975:Sgk2 UTSW 2 163004160 missense probably benign
R1977:Sgk2 UTSW 2 163004160 missense probably benign
R2085:Sgk2 UTSW 2 163012970 missense probably damaging 1.00
R2136:Sgk2 UTSW 2 162999179 splice site probably null
R2873:Sgk2 UTSW 2 162994529 splice site probably benign
R2874:Sgk2 UTSW 2 162994529 splice site probably benign
R2919:Sgk2 UTSW 2 162999195 missense probably damaging 1.00
R2919:Sgk2 UTSW 2 162999205 missense probably damaging 1.00
R4602:Sgk2 UTSW 2 162994754 critical splice donor site probably null
R4660:Sgk2 UTSW 2 162997843 missense possibly damaging 0.95
R5517:Sgk2 UTSW 2 162997835 missense probably damaging 1.00
R5531:Sgk2 UTSW 2 162994704 missense probably benign 0.00
R6143:Sgk2 UTSW 2 162999254 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACGGTACAGTACGGTACGGTACG -3'
(R):5'- GCTGCCTTGCATGAATCACTGAGAC -3'

Sequencing Primer
(F):5'- gtacggtacggGTGCTGAG -3'
(R):5'- gcatgaatcactgagactctcc -3'
Posted On2013-11-08