Incidental Mutation 'R0947:Spsb1'
ID81656
Institutional Source Beutler Lab
Gene Symbol Spsb1
Ensembl Gene ENSMUSG00000039911
Gene NamesplA/ryanodine receptor domain and SOCS box containing 1
Synonyms1110014L01Rik, SSB1, 4930422J18Rik
MMRRC Submission 039086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R0947 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location149896283-149955043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 149907079 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 11 (T11A)
Ref Sequence ENSEMBL: ENSMUSP00000119558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038562] [ENSMUST00000105684] [ENSMUST00000105685] [ENSMUST00000125135] [ENSMUST00000149360] [ENSMUST00000149743] [ENSMUST00000156897] [ENSMUST00000167342]
Predicted Effect probably benign
Transcript: ENSMUST00000038562
AA Change: T11A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048969
Gene: ENSMUSG00000039911
AA Change: T11A

DomainStartEndE-ValueType
SPRY 95 230 4.93e-19 SMART
SOCS_box 234 273 2.04e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105684
AA Change: T11A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101309
Gene: ENSMUSG00000039911
AA Change: T11A

DomainStartEndE-ValueType
SPRY 95 230 4.93e-19 SMART
SOCS_box 234 273 2.04e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105685
AA Change: T11A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101310
Gene: ENSMUSG00000039911
AA Change: T11A

DomainStartEndE-ValueType
SPRY 95 230 4.93e-19 SMART
SOCS_box 234 273 2.04e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125135
AA Change: T11A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146532
Predicted Effect probably benign
Transcript: ENSMUST00000149360
AA Change: T11A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect unknown
Transcript: ENSMUST00000149743
AA Change: T11A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156451
Predicted Effect probably benign
Transcript: ENSMUST00000156897
AA Change: T11A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119558
Gene: ENSMUSG00000039911
AA Change: T11A

DomainStartEndE-ValueType
Pfam:SPRY 95 201 5.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167342
AA Change: T11A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.2%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh7a1 A T 18: 56,560,838 probably null Het
Atm A G 9: 53,504,092 V833A probably benign Het
Atp6v1b1 A T 6: 83,753,832 I180F probably damaging Het
Cwf19l2 T C 9: 3,421,286 S188P probably benign Het
Gdpd1 T G 11: 87,037,881 E240D probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Htt T C 5: 34,898,924 S2681P probably damaging Het
Itgad A G 7: 128,175,693 D40G probably benign Het
Krt18 A G 15: 102,030,728 Y249C possibly damaging Het
Lrp2 G T 2: 69,487,838 P2090T probably damaging Het
Lrrc32 A G 7: 98,498,883 D290G probably benign Het
Man1a A T 10: 53,933,523 Y486* probably null Het
Mcm9 CCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCC CCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCC 10: 53,537,501 probably benign Het
Nin A T 12: 70,061,186 C211S probably damaging Het
Npat A C 9: 53,570,324 I1111L probably benign Het
Olfr1505 T A 19: 13,919,171 H50Q probably benign Het
Olfr507 A G 7: 108,622,672 I287V probably benign Het
Pbx1 A G 1: 168,203,366 S228P probably damaging Het
Pcsk7 G T 9: 45,911,172 R230L probably damaging Het
Prom2 G T 2: 127,538,263 Q350K possibly damaging Het
Racgap1 C T 15: 99,624,314 A458T possibly damaging Het
Rsf1 T A 7: 97,669,778 C912S probably damaging Het
Setd2 G A 9: 110,548,511 E465K possibly damaging Het
Sgk2 T A 2: 163,006,838 D269E probably benign Het
Tln2 A T 9: 67,295,813 S509T probably benign Het
Trim5 A T 7: 104,265,751 D370E probably damaging Het
Ttn T A 2: 76,885,230 probably benign Het
Ubr2 C A 17: 46,941,112 G1501C probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r93 A T 17: 18,304,081 R112S probably benign Het
Vps26b T C 9: 27,012,781 Y222C probably damaging Het
Wdr64 T A 1: 175,775,749 Y198N probably benign Het
Xrn1 A T 9: 95,998,263 K752I possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp386 T C 12: 116,059,778 I372T probably benign Het
Zfp804a T C 2: 82,258,718 Y964H possibly damaging Het
Other mutations in Spsb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Spsb1 APN 4 149907107 start codon destroyed probably null 1.00
LCD18:Spsb1 UTSW 4 149952486 intron probably benign
R0200:Spsb1 UTSW 4 149898216 makesense probably null
R0681:Spsb1 UTSW 4 149906917 missense probably benign
R0733:Spsb1 UTSW 4 149906917 missense probably benign
R0894:Spsb1 UTSW 4 149906415 critical splice donor site probably null
R1840:Spsb1 UTSW 4 149906631 missense probably damaging 0.99
R1845:Spsb1 UTSW 4 149906910 missense probably damaging 1.00
R4356:Spsb1 UTSW 4 149906775 missense probably damaging 1.00
R4357:Spsb1 UTSW 4 149906775 missense probably damaging 1.00
R4358:Spsb1 UTSW 4 149906775 missense probably damaging 1.00
R4359:Spsb1 UTSW 4 149906775 missense probably damaging 1.00
R4656:Spsb1 UTSW 4 149906410 splice site probably null
R4970:Spsb1 UTSW 4 149907155 start gained probably benign
R6304:Spsb1 UTSW 4 149906731 missense probably benign 0.30
R6767:Spsb1 UTSW 4 149906844 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTACCCAACTTTGCCCCTGATG -3'
(R):5'- GACCTTTGGAGATCGCCTAGCAAC -3'

Sequencing Primer
(F):5'- CCGGTGAAAGATCAACTTGTC -3'
(R):5'- GCCTAGCAACCTCCCTTAG -3'
Posted On2013-11-08