Incidental Mutation 'R0947:Lrrc32'
ID81663
Institutional Source Beutler Lab
Gene Symbol Lrrc32
Ensembl Gene ENSMUSG00000090958
Gene Nameleucine rich repeat containing 32
SynonymsD7H11S833E, EG434215, Garp, D11S833Eh
MMRRC Submission 039086-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R0947 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location98489283-98502181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98498883 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 290 (D290G)
Ref Sequence ENSEMBL: ENSMUSP00000145859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165205] [ENSMUST00000205937] [ENSMUST00000205956]
Predicted Effect probably benign
Transcript: ENSMUST00000165205
AA Change: D290G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133205
Gene: ENSMUSG00000090958
AA Change: D290G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:LRRNT 22 54 3e-12 BLAST
LRR_TYP 73 96 9.44e-2 SMART
LRR 97 123 1.86e2 SMART
LRR 124 148 3.01e2 SMART
LRR 149 172 5.41e0 SMART
LRR 173 196 1.51e0 SMART
LRR_TYP 197 220 7.67e-2 SMART
LRR 265 287 1.49e2 SMART
LRR 315 338 4.97e0 SMART
LRR 339 362 8.01e0 SMART
LRR 363 384 5.57e1 SMART
LRR_TYP 386 409 3.44e-4 SMART
low complexity region 425 437 N/A INTRINSIC
LRR 443 466 2.33e2 SMART
LRR 514 536 2.03e1 SMART
LRR 537 559 2.61e1 SMART
Blast:LRR 561 588 6e-11 BLAST
transmembrane domain 630 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205937
Predicted Effect probably benign
Transcript: ENSMUST00000205956
AA Change: D290G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.2%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I membrane protein which contains 20 leucine-rich repeats. Alterations in the chromosomal region 11q13-11q14 are involved in several pathologies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in T cells exhibit reduced regulatory T cell ability to drive Th17 differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh7a1 A T 18: 56,560,838 probably null Het
Atm A G 9: 53,504,092 V833A probably benign Het
Atp6v1b1 A T 6: 83,753,832 I180F probably damaging Het
Cwf19l2 T C 9: 3,421,286 S188P probably benign Het
Gdpd1 T G 11: 87,037,881 E240D probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Htt T C 5: 34,898,924 S2681P probably damaging Het
Itgad A G 7: 128,175,693 D40G probably benign Het
Krt18 A G 15: 102,030,728 Y249C possibly damaging Het
Lrp2 G T 2: 69,487,838 P2090T probably damaging Het
Man1a A T 10: 53,933,523 Y486* probably null Het
Mcm9 CCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCC CCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCC 10: 53,537,501 probably benign Het
Nin A T 12: 70,061,186 C211S probably damaging Het
Npat A C 9: 53,570,324 I1111L probably benign Het
Olfr1505 T A 19: 13,919,171 H50Q probably benign Het
Olfr507 A G 7: 108,622,672 I287V probably benign Het
Pbx1 A G 1: 168,203,366 S228P probably damaging Het
Pcsk7 G T 9: 45,911,172 R230L probably damaging Het
Prom2 G T 2: 127,538,263 Q350K possibly damaging Het
Racgap1 C T 15: 99,624,314 A458T possibly damaging Het
Rsf1 T A 7: 97,669,778 C912S probably damaging Het
Setd2 G A 9: 110,548,511 E465K possibly damaging Het
Sgk2 T A 2: 163,006,838 D269E probably benign Het
Spsb1 T C 4: 149,907,079 T11A probably benign Het
Tln2 A T 9: 67,295,813 S509T probably benign Het
Trim5 A T 7: 104,265,751 D370E probably damaging Het
Ttn T A 2: 76,885,230 probably benign Het
Ubr2 C A 17: 46,941,112 G1501C probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r93 A T 17: 18,304,081 R112S probably benign Het
Vps26b T C 9: 27,012,781 Y222C probably damaging Het
Wdr64 T A 1: 175,775,749 Y198N probably benign Het
Xrn1 A T 9: 95,998,263 K752I possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp386 T C 12: 116,059,778 I372T probably benign Het
Zfp804a T C 2: 82,258,718 Y964H possibly damaging Het
Other mutations in Lrrc32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Lrrc32 APN 7 98498376 missense probably damaging 1.00
IGL01484:Lrrc32 APN 7 98494235 missense probably damaging 0.99
IGL01608:Lrrc32 APN 7 98499357 missense probably benign 0.01
IGL02025:Lrrc32 APN 7 98499560 missense probably benign 0.00
IGL02026:Lrrc32 APN 7 98499560 missense probably benign 0.00
IGL03061:Lrrc32 APN 7 98499422 missense probably benign 0.04
IGL03191:Lrrc32 APN 7 98498247 missense possibly damaging 0.66
R0706:Lrrc32 UTSW 7 98499710 missense probably damaging 1.00
R1470:Lrrc32 UTSW 7 98499357 missense probably benign
R1470:Lrrc32 UTSW 7 98499357 missense probably benign
R2879:Lrrc32 UTSW 7 98499777 missense probably benign 0.02
R3608:Lrrc32 UTSW 7 98499186 missense probably benign 0.09
R4417:Lrrc32 UTSW 7 98498937 missense probably benign 0.01
R4798:Lrrc32 UTSW 7 98499017 missense probably damaging 1.00
R4872:Lrrc32 UTSW 7 98498520 missense probably damaging 0.99
R5813:Lrrc32 UTSW 7 98498411 missense probably damaging 1.00
R6062:Lrrc32 UTSW 7 98498541 missense probably benign 0.00
R6742:Lrrc32 UTSW 7 98498832 missense probably benign 0.00
R6930:Lrrc32 UTSW 7 98499264 missense possibly damaging 0.89
Z1088:Lrrc32 UTSW 7 98499060 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATCTCAGACTTCAGCCTCCAGCAG -3'
(R):5'- CCTCAAAGGATCGCAGGCAGTTTC -3'

Sequencing Primer
(F):5'- CTTGAGCTGCAACAGCATTG -3'
(R):5'- GCAGGCAGTTTCTGCTGAG -3'
Posted On2013-11-08