Incidental Mutation 'R0948:Hsh2d'
ID81711
Institutional Source Beutler Lab
Gene Symbol Hsh2d
Ensembl Gene ENSMUSG00000062007
Gene Namehematopoietic SH2 domain containing
SynonymsALX, Hsh2
MMRRC Submission 039087-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0948 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72189638-72201527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72200460 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 229 (D229N)
Ref Sequence ENSEMBL: ENSMUSP00000127575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072097] [ENSMUST00000098630] [ENSMUST00000165324]
Predicted Effect probably benign
Transcript: ENSMUST00000072097
AA Change: D229N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000071970
Gene: ENSMUSG00000062007
AA Change: D229N

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098630
SMART Domains Protein: ENSMUSP00000096231
Gene: ENSMUSG00000074240

DomainStartEndE-ValueType
EFh 43 71 3.97e1 SMART
EFh 80 108 4.32e1 SMART
EFh 121 149 1.57e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165324
AA Change: D229N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000127575
Gene: ENSMUSG00000062007
AA Change: D229N

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211946
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] T-cell activation requires 2 signals: recognition of antigen by the T-cell receptor (see TCR; MIM 186880) and a costimulatory signal provided primarily by CD28 (MIM 186760) in naive T cells. HSH2 is a target of both of these signaling pathways (Greene et al., 2003 [PubMed 12960172]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced IL-2 production, increased T cell proliferation in response to TCR/CD28 stimulation, splenomegaly, and an increased frequency of activated T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik C T 19: 8,890,026 T63M probably damaging Het
Abcb1a T A 5: 8,740,621 probably null Het
Ahrr T C 13: 74,213,769 D537G probably damaging Het
Anxa4 T A 6: 86,741,931 I269F probably damaging Het
Atm A T 9: 53,495,958 M1160K probably benign Het
Ccdc175 A G 12: 72,131,123 Y434H probably damaging Het
Col19a1 C T 1: 24,296,801 A855T probably damaging Het
Cyp2a4 A G 7: 26,310,788 D246G probably damaging Het
Dmbt1 T C 7: 131,093,117 L840P possibly damaging Het
Dock6 A T 9: 21,801,533 D2009E probably damaging Het
Doxl2 A G 6: 48,976,344 Y401C probably damaging Het
E2f3 C T 13: 29,985,533 A46T probably damaging Het
Ect2l A T 10: 18,140,586 C635S probably damaging Het
Fam129b A G 2: 32,922,860 Y480C probably damaging Het
Fer1l6 A G 15: 58,564,075 D439G probably benign Het
Gm5434 A T 12: 36,090,935 probably benign Het
Hao1 A C 2: 134,530,773 M105R probably damaging Het
Igsf10 A G 3: 59,331,104 I552T probably damaging Het
Il31ra A G 13: 112,530,378 S470P possibly damaging Het
Mfsd1 A G 3: 67,596,734 N353S possibly damaging Het
Mga T A 2: 119,941,659 F1667I possibly damaging Het
Nwd2 T C 5: 63,807,312 V1413A probably damaging Het
Olfr906 T G 9: 38,488,948 S306R probably benign Het
Olfr914 G A 9: 38,606,491 V9I possibly damaging Het
Osbpl10 T A 9: 115,167,119 V119E probably damaging Het
Plec C A 15: 76,205,687 R151L probably benign Het
Ptpn12 T C 5: 20,998,043 H579R probably benign Het
Rnase4 G T 14: 51,104,905 G29C probably damaging Het
Sim1 C A 10: 50,981,327 S391* probably null Het
Sobp A T 10: 43,022,209 I460N probably damaging Het
Spns3 A T 11: 72,545,940 D75E probably damaging Het
Strn4 T A 7: 16,837,713 C26* probably null Het
Tacstd2 T A 6: 67,535,118 I197L probably damaging Het
Trpc6 A G 9: 8,610,415 T295A possibly damaging Het
Txnl1 G T 18: 63,692,120 S18R possibly damaging Het
U2surp A G 9: 95,461,497 probably benign Het
Vwce A G 19: 10,653,077 Y500C probably damaging Het
Wdr49 A C 3: 75,450,851 S196A probably benign Het
Wfs1 T C 5: 36,967,561 Y662C probably damaging Het
Wnt8b A C 19: 44,510,529 D133A possibly damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp532 C A 18: 65,623,818 A274E probably damaging Het
Zfp74 A G 7: 29,935,937 probably null Het
Other mutations in Hsh2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Hsh2d APN 8 72200619 missense probably damaging 0.98
IGL01134:Hsh2d APN 8 72193531 missense probably damaging 0.96
IGL01778:Hsh2d APN 8 72193507 missense probably damaging 1.00
IGL03324:Hsh2d APN 8 72193512 missense probably damaging 1.00
R0002:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0064:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0309:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0312:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0369:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0449:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0450:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0481:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0483:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0554:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0704:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0843:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0947:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0966:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0967:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1051:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1055:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1076:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1105:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1108:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1144:Hsh2d UTSW 8 72193592 splice site probably benign
R1150:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1186:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1345:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1371:Hsh2d UTSW 8 72196894 splice site probably benign
R1400:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1419:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1430:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1514:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1551:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1691:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1857:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1859:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1914:Hsh2d UTSW 8 72193521 missense probably damaging 1.00
R1915:Hsh2d UTSW 8 72193521 missense probably damaging 1.00
R1982:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2050:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2081:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2105:Hsh2d UTSW 8 72200646 missense probably benign
R4077:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4078:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4823:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4824:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4903:Hsh2d UTSW 8 72193528 missense probably benign
R4966:Hsh2d UTSW 8 72193528 missense probably benign
R6550:Hsh2d UTSW 8 72198453 missense probably benign
R7418:Hsh2d UTSW 8 72196794 critical splice acceptor site probably null
Y4335:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4336:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4337:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4338:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCACACTTGCAGTCCAACTGTGTC -3'
(R):5'- GCTTTGACCCCTGAGAATGCCTTC -3'

Sequencing Primer
(F):5'- GCTTCTGAAAGGAAGCCATC -3'
(R):5'- GAGAATGCCTTCCTCCAGC -3'
Posted On2013-11-08