Incidental Mutation 'R0948:Olfr914'
ID81715
Institutional Source Beutler Lab
Gene Symbol Olfr914
Ensembl Gene ENSMUSG00000047050
Gene Nameolfactory receptor 914
SynonymsMOR165-7, GA_x6K02T2PVTD-32308823-32309773
MMRRC Submission 039087-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R0948 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38605102-38610978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38606491 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 9 (V9I)
Ref Sequence ENSEMBL: ENSMUSP00000150241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057755] [ENSMUST00000217057]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057755
AA Change: V9I

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053405
Gene: ENSMUSG00000047050
AA Change: V9I

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 1.1e-48 PFAM
Pfam:7tm_1 41 290 5.2e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217057
AA Change: V9I

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik C T 19: 8,890,026 T63M probably damaging Het
Abcb1a T A 5: 8,740,621 probably null Het
Ahrr T C 13: 74,213,769 D537G probably damaging Het
Anxa4 T A 6: 86,741,931 I269F probably damaging Het
Atm A T 9: 53,495,958 M1160K probably benign Het
Ccdc175 A G 12: 72,131,123 Y434H probably damaging Het
Col19a1 C T 1: 24,296,801 A855T probably damaging Het
Cyp2a4 A G 7: 26,310,788 D246G probably damaging Het
Dmbt1 T C 7: 131,093,117 L840P possibly damaging Het
Dock6 A T 9: 21,801,533 D2009E probably damaging Het
Doxl2 A G 6: 48,976,344 Y401C probably damaging Het
E2f3 C T 13: 29,985,533 A46T probably damaging Het
Ect2l A T 10: 18,140,586 C635S probably damaging Het
Fam129b A G 2: 32,922,860 Y480C probably damaging Het
Fer1l6 A G 15: 58,564,075 D439G probably benign Het
Gm5434 A T 12: 36,090,935 probably benign Het
Hao1 A C 2: 134,530,773 M105R probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igsf10 A G 3: 59,331,104 I552T probably damaging Het
Il31ra A G 13: 112,530,378 S470P possibly damaging Het
Mfsd1 A G 3: 67,596,734 N353S possibly damaging Het
Mga T A 2: 119,941,659 F1667I possibly damaging Het
Nwd2 T C 5: 63,807,312 V1413A probably damaging Het
Olfr906 T G 9: 38,488,948 S306R probably benign Het
Osbpl10 T A 9: 115,167,119 V119E probably damaging Het
Plec C A 15: 76,205,687 R151L probably benign Het
Ptpn12 T C 5: 20,998,043 H579R probably benign Het
Rnase4 G T 14: 51,104,905 G29C probably damaging Het
Sim1 C A 10: 50,981,327 S391* probably null Het
Sobp A T 10: 43,022,209 I460N probably damaging Het
Spns3 A T 11: 72,545,940 D75E probably damaging Het
Strn4 T A 7: 16,837,713 C26* probably null Het
Tacstd2 T A 6: 67,535,118 I197L probably damaging Het
Trpc6 A G 9: 8,610,415 T295A possibly damaging Het
Txnl1 G T 18: 63,692,120 S18R possibly damaging Het
U2surp A G 9: 95,461,497 probably benign Het
Vwce A G 19: 10,653,077 Y500C probably damaging Het
Wdr49 A C 3: 75,450,851 S196A probably benign Het
Wfs1 T C 5: 36,967,561 Y662C probably damaging Het
Wnt8b A C 19: 44,510,529 D133A possibly damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp532 C A 18: 65,623,818 A274E probably damaging Het
Zfp74 A G 7: 29,935,937 probably null Het
Other mutations in Olfr914
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Olfr914 APN 9 38606554 missense probably null 0.00
IGL01758:Olfr914 APN 9 38607293 missense probably damaging 0.99
IGL02003:Olfr914 APN 9 38606840 missense probably damaging 1.00
IGL02203:Olfr914 APN 9 38607423 utr 3 prime probably benign
IGL02233:Olfr914 APN 9 38607242 missense probably damaging 1.00
IGL02408:Olfr914 APN 9 38607121 missense possibly damaging 0.62
IGL02882:Olfr914 APN 9 38606938 missense probably benign 0.04
IGL03081:Olfr914 APN 9 38606870 missense probably benign 0.01
IGL03088:Olfr914 APN 9 38607301 missense probably damaging 0.99
IGL03177:Olfr914 APN 9 38606571 nonsense probably null
IGL03219:Olfr914 APN 9 38606951 missense probably benign 0.28
P0023:Olfr914 UTSW 9 38606645 missense probably damaging 1.00
R0630:Olfr914 UTSW 9 38606896 missense probably benign 0.01
R1451:Olfr914 UTSW 9 38606938 missense probably benign 0.04
R1681:Olfr914 UTSW 9 38606948 missense probably damaging 0.99
R2402:Olfr914 UTSW 9 38607101 missense probably benign 0.02
R5854:Olfr914 UTSW 9 38606663 missense probably damaging 1.00
R6857:Olfr914 UTSW 9 38607011 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCACAAAAGGTCCTCAGTCTCAGC -3'
(R):5'- TGGATCATGGCACCTGAAAATCCC -3'

Sequencing Primer
(F):5'- TCTCAGCAAGGTGGACCATTATC -3'
(R):5'- ATCATAGGCCATTGCTGTCAG -3'
Posted On2013-11-08