Incidental Mutation 'R0960:Pde1a'
ID81810
Institutional Source Beutler Lab
Gene Symbol Pde1a
Ensembl Gene ENSMUSG00000059173
Gene Namephosphodiesterase 1A, calmodulin-dependent
Synonyms
MMRRC Submission 039089-MU
Accession Numbers

Genbank: NM_001159582, NM_016744, NM_001009978, NM_001009979

Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R0960 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location79834453-80129458 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 79865034 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090756] [ENSMUST00000102651] [ENSMUST00000102652] [ENSMUST00000102653] [ENSMUST00000102654] [ENSMUST00000102655] [ENSMUST00000183775]
Predicted Effect probably benign
Transcript: ENSMUST00000090756
SMART Domains Protein: ENSMUSP00000088260
Gene: ENSMUSG00000059173

DomainStartEndE-ValueType
Pfam:PDEase_I_N 1 29 3.4e-11 PFAM
HDc 112 276 5.19e-7 SMART
low complexity region 344 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102651
SMART Domains Protein: ENSMUSP00000099711
Gene: ENSMUSG00000059173

DomainStartEndE-ValueType
Pfam:PDEase_I_N 5 65 9.3e-32 PFAM
HDc 148 312 5.19e-7 SMART
low complexity region 380 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102652
SMART Domains Protein: ENSMUSP00000099712
Gene: ENSMUSG00000059173

DomainStartEndE-ValueType
Pfam:PDEase_I_N 5 65 9e-32 PFAM
HDc 148 312 5.19e-7 SMART
low complexity region 380 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102653
SMART Domains Protein: ENSMUSP00000099713
Gene: ENSMUSG00000059173

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 1.2e-31 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102654
SMART Domains Protein: ENSMUSP00000099714
Gene: ENSMUSG00000059173

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 1.2e-31 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102655
SMART Domains Protein: ENSMUSP00000099715
Gene: ENSMUSG00000059173

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 7.8e-35 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134739
SMART Domains Protein: ENSMUSP00000120188
Gene: ENSMUSG00000059173

DomainStartEndE-ValueType
Pfam:PDEase_I_N 41 101 1.4e-35 PFAM
HDc 184 348 5.19e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183775
SMART Domains Protein: ENSMUSP00000139327
Gene: ENSMUSG00000059173

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 1.2e-31 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cyclic nucleotide phosphodiesterases (PDEs) play a role in signal transduction by regulating intracellular cyclic nucleotide concentrations through hydrolysis of cAMP and/or cGMP to their respective nucleoside 5-prime monophosphates. Members of the PDE1 family, such as PDE1A, are Ca(2+)/calmodulin (see CALM1; MIM 114180)-dependent PDEs (CaM-PDEs) that are activated by calmodulin in the presence of Ca(2+) (Michibata et al., 2001 [PubMed 11342109]; Fidock et al., 2002 [PubMed 11747989]).[supplied by OMIM, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,890,428 V256A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930474N05Rik C A 14: 36,096,410 H122N probably benign Het
Aamp T C 1: 74,281,145 T341A possibly damaging Het
Adam26a A T 8: 43,568,763 H563Q probably damaging Het
Ankrd13a G A 5: 114,786,807 E118K probably benign Het
Asic5 A G 3: 82,006,540 I174V probably benign Het
Atad2b G A 12: 5,006,593 probably benign Het
Bub1b A G 2: 118,606,680 I120V probably benign Het
Casp8 T C 1: 58,829,013 probably null Het
Cdk5rap2 A G 4: 70,243,508 Y254H probably benign Het
Clasp1 T C 1: 118,552,026 I996T probably benign Het
Cntn6 A G 6: 104,774,480 I294V probably benign Het
Flnc A G 6: 29,441,512 D431G probably damaging Het
Gm4884 T A 7: 41,042,808 M67K possibly damaging Het
Hmx3 T C 7: 131,543,314 Y118H probably benign Het
Hsf2bp C T 17: 32,007,769 R204H probably damaging Het
Il12b G T 11: 44,408,488 C128F probably damaging Het
Ints6 T C 14: 62,709,566 M317V probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Kif27 T C 13: 58,323,967 E769G probably damaging Het
Kif28 G A 1: 179,695,805 Q987* probably null Het
Klhdc3 T C 17: 46,676,518 H330R possibly damaging Het
Leo1 G A 9: 75,445,240 E22K probably benign Het
Lpcat2 C T 8: 92,869,710 T125M probably benign Het
Map1a A G 2: 121,301,643 Y742C probably benign Het
Mllt6 C T 11: 97,664,946 probably benign Het
Mpp2 A G 11: 102,061,585 V354A possibly damaging Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Myo10 A G 15: 25,801,189 E1488G probably damaging Het
Neb A G 2: 52,212,983 V4461A probably benign Het
Nudcd1 G T 15: 44,427,651 probably benign Het
Olfr1129 T C 2: 87,575,935 Y284H probably benign Het
Olfr1369-ps1 A C 13: 21,116,265 D191A possibly damaging Het
Sdha A T 13: 74,323,184 probably benign Het
Selenoo T G 15: 89,096,754 I432S probably benign Het
Sh3gl2 A T 4: 85,377,480 I140F probably damaging Het
Svopl G T 6: 38,017,057 Y346* probably null Het
Tbc1d17 C T 7: 44,848,428 probably benign Het
Tlr3 A C 8: 45,397,415 I815S probably damaging Het
Tmem25 T A 9: 44,795,512 probably null Het
Tpd52 A T 3: 8,943,590 probably null Het
Tspoap1 A T 11: 87,770,595 probably benign Het
Txndc11 A T 16: 11,091,589 D364E probably benign Het
Unc5cl G T 17: 48,459,596 probably benign Het
Vmn1r13 A G 6: 57,210,011 M52V probably benign Het
Zap70 T C 1: 36,779,173 Y314H probably damaging Het
Other mutations in Pde1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Pde1a APN 2 79865670 missense probably damaging 1.00
IGL01860:Pde1a APN 2 79875284 missense probably damaging 1.00
IGL02059:Pde1a APN 2 79897077 missense possibly damaging 0.64
IGL02307:Pde1a APN 2 79906068 missense possibly damaging 0.70
IGL02376:Pde1a APN 2 79875223 splice site probably benign
IGL02569:Pde1a APN 2 79868258 missense probably benign 0.04
IGL03038:Pde1a APN 2 79887946 splice site probably benign
G5030:Pde1a UTSW 2 79887836 splice site probably benign
R0099:Pde1a UTSW 2 79868313 critical splice acceptor site probably null
R0549:Pde1a UTSW 2 79865070 missense probably damaging 1.00
R1855:Pde1a UTSW 2 79898064 critical splice donor site probably null
R1907:Pde1a UTSW 2 79868307 missense probably damaging 1.00
R1972:Pde1a UTSW 2 79865721 missense probably damaging 0.99
R2262:Pde1a UTSW 2 80128931 start gained probably benign
R4658:Pde1a UTSW 2 79898181 critical splice acceptor site probably benign
R4674:Pde1a UTSW 2 79898181 critical splice acceptor site probably benign
R4842:Pde1a UTSW 2 80128837 utr 5 prime probably benign
R4878:Pde1a UTSW 2 79878139 missense probably benign 0.05
R5161:Pde1a UTSW 2 79878144 missense probably null 1.00
R5473:Pde1a UTSW 2 79906028 missense probably damaging 1.00
R5940:Pde1a UTSW 2 79887839 critical splice donor site probably null
R5976:Pde1a UTSW 2 79868242 nonsense probably null
R6016:Pde1a UTSW 2 79865062 missense probably benign 0.01
R6242:Pde1a UTSW 2 80128792 missense probably benign
R6248:Pde1a UTSW 2 79878201 missense probably damaging 1.00
R6609:Pde1a UTSW 2 79906140 missense probably damaging 1.00
R6858:Pde1a UTSW 2 80129158 unclassified probably benign
X0025:Pde1a UTSW 2 79838930 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGCAAGTACCAGTGACAAAGCACAG -3'
(R):5'- AGGCGGTCAAATACAAAAGGCTCC -3'

Sequencing Primer
(F):5'- TGCAGCTCAAGTGACATAAGC -3'
(R):5'- CAAAAGGCTCCGTGTGTGATG -3'
Posted On2013-11-08