Incidental Mutation 'R0960:1810009A15Rik'
ID81849
Institutional Source Beutler Lab
Gene Symbol 1810009A15Rik
Ensembl Gene ENSMUSG00000071653
Gene NameRIKEN cDNA 1810009A15 gene
Synonyms
MMRRC Submission 039089-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R0960 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8888853-8890881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8890428 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 256 (V256A)
Ref Sequence ENSEMBL: ENSMUSP00000139692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096249] [ENSMUST00000096251] [ENSMUST00000177826] [ENSMUST00000185488] [ENSMUST00000187504] [ENSMUST00000191089]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093658
Predicted Effect probably benign
Transcript: ENSMUST00000096249
SMART Domains Protein: ENSMUSP00000093968
Gene: ENSMUSG00000071652

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:INTS5_N 29 252 1e-82 PFAM
low complexity region 254 267 N/A INTRINSIC
Pfam:INTS5_C 289 998 2.2e-249 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096251
AA Change: S94P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093970
Gene: ENSMUSG00000071653
AA Change: S94P

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175573
Predicted Effect probably benign
Transcript: ENSMUST00000177826
SMART Domains Protein: ENSMUSP00000137432
Gene: ENSMUSG00000116166

DomainStartEndE-ValueType
Pfam:Lbh 1 101 1.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185488
SMART Domains Protein: ENSMUSP00000140221
Gene: ENSMUSG00000071653

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187037
Predicted Effect probably benign
Transcript: ENSMUST00000187504
AA Change: V256A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139692
Gene: ENSMUSG00000096740
AA Change: V256A

DomainStartEndE-ValueType
Pfam:Lbh 1 101 2.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190843
Predicted Effect probably benign
Transcript: ENSMUST00000191089
SMART Domains Protein: ENSMUSP00000140564
Gene: ENSMUSG00000116347

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
Meta Mutation Damage Score 0.1256 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930474N05Rik C A 14: 36,096,410 H122N probably benign Het
Aamp T C 1: 74,281,145 T341A possibly damaging Het
Adam26a A T 8: 43,568,763 H563Q probably damaging Het
Ankrd13a G A 5: 114,786,807 E118K probably benign Het
Asic5 A G 3: 82,006,540 I174V probably benign Het
Atad2b G A 12: 5,006,593 probably benign Het
Bub1b A G 2: 118,606,680 I120V probably benign Het
Casp8 T C 1: 58,829,013 probably null Het
Cdk5rap2 A G 4: 70,243,508 Y254H probably benign Het
Clasp1 T C 1: 118,552,026 I996T probably benign Het
Cntn6 A G 6: 104,774,480 I294V probably benign Het
Flnc A G 6: 29,441,512 D431G probably damaging Het
Gm4884 T A 7: 41,042,808 M67K possibly damaging Het
Hmx3 T C 7: 131,543,314 Y118H probably benign Het
Hsf2bp C T 17: 32,007,769 R204H probably damaging Het
Il12b G T 11: 44,408,488 C128F probably damaging Het
Ints6 T C 14: 62,709,566 M317V probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Kif27 T C 13: 58,323,967 E769G probably damaging Het
Kif28 G A 1: 179,695,805 Q987* probably null Het
Klhdc3 T C 17: 46,676,518 H330R possibly damaging Het
Leo1 G A 9: 75,445,240 E22K probably benign Het
Lpcat2 C T 8: 92,869,710 T125M probably benign Het
Map1a A G 2: 121,301,643 Y742C probably benign Het
Mllt6 C T 11: 97,664,946 probably benign Het
Mpp2 A G 11: 102,061,585 V354A possibly damaging Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Myo10 A G 15: 25,801,189 E1488G probably damaging Het
Neb A G 2: 52,212,983 V4461A probably benign Het
Nudcd1 G T 15: 44,427,651 probably benign Het
Olfr1129 T C 2: 87,575,935 Y284H probably benign Het
Olfr1369-ps1 A C 13: 21,116,265 D191A possibly damaging Het
Pde1a G A 2: 79,865,034 probably benign Het
Sdha A T 13: 74,323,184 probably benign Het
Selenoo T G 15: 89,096,754 I432S probably benign Het
Sh3gl2 A T 4: 85,377,480 I140F probably damaging Het
Svopl G T 6: 38,017,057 Y346* probably null Het
Tbc1d17 C T 7: 44,848,428 probably benign Het
Tlr3 A C 8: 45,397,415 I815S probably damaging Het
Tmem25 T A 9: 44,795,512 probably null Het
Tpd52 A T 3: 8,943,590 probably null Het
Tspoap1 A T 11: 87,770,595 probably benign Het
Txndc11 A T 16: 11,091,589 D364E probably benign Het
Unc5cl G T 17: 48,459,596 probably benign Het
Vmn1r13 A G 6: 57,210,011 M52V probably benign Het
Zap70 T C 1: 36,779,173 Y314H probably damaging Het
Other mutations in 1810009A15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0948:1810009A15Rik UTSW 19 8890026 missense probably damaging 1.00
R1412:1810009A15Rik UTSW 19 8889995 splice site probably benign
R2887:1810009A15Rik UTSW 19 8890031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGGGCACAGAGGCTACACAAC -3'
(R):5'- TGCACTTCATCCCACACGGTGAAC -3'

Sequencing Primer
(F):5'- cactccagaagagggcatc -3'
(R):5'- TCAGGGTCCGCTGTAGAAG -3'
Posted On2013-11-08