Incidental Mutation 'R0961:Olfr1008'
ID81859
Institutional Source Beutler Lab
Gene Symbol Olfr1008
Ensembl Gene ENSMUSG00000050603
Gene Nameolfactory receptor 1008
SynonymsMOR187-3, GA_x6K02T2Q125-47170431-47171372
MMRRC Submission 039090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0961 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85689431-85690372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85689446 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 6 (T6S)
Ref Sequence ENSEMBL: ENSMUSP00000061191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054868]
Predicted Effect probably benign
Transcript: ENSMUST00000054868
AA Change: T6S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000061191
Gene: ENSMUSG00000050603
AA Change: T6S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-46 PFAM
Pfam:7tm_1 41 290 2.4e-14 PFAM
Meta Mutation Damage Score 0.1156 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Arhgap22 C T 14: 33,367,113 T352M probably damaging Het
Atg9a G A 1: 75,186,746 L237F probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Dmpk C G 7: 19,087,270 D204E probably damaging Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fam83b A T 9: 76,491,295 I842N probably damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fzd6 C T 15: 39,025,678 L64F probably damaging Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gbp7 C A 3: 142,541,557 S276* probably null Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Kdm2a A G 19: 4,329,191 V92A probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Lrig1 A G 6: 94,663,914 probably benign Het
Mep1b T A 18: 21,088,729 Y245* probably null Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr130 T A 17: 38,067,923 Y251N probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Phactr4 A G 4: 132,378,420 S112P probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Rere A G 4: 150,615,372 probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc10a5 T C 3: 10,334,424 H392R probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Spata31d1b T C 13: 59,717,804 V922A possibly damaging Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Usp18 G A 6: 121,261,493 A200T probably benign Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Olfr1008
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Olfr1008 APN 2 85689663 missense probably benign 0.01
IGL02192:Olfr1008 APN 2 85690128 missense possibly damaging 0.80
IGL02560:Olfr1008 APN 2 85689519 missense possibly damaging 0.79
IGL02726:Olfr1008 APN 2 85690210 missense possibly damaging 0.94
IGL02756:Olfr1008 APN 2 85690058 missense probably damaging 0.99
R0463:Olfr1008 UTSW 2 85689839 missense possibly damaging 0.94
R0964:Olfr1008 UTSW 2 85690365 missense probably benign
R1259:Olfr1008 UTSW 2 85689531 missense probably damaging 0.98
R1756:Olfr1008 UTSW 2 85690083 missense probably damaging 1.00
R1871:Olfr1008 UTSW 2 85690311 missense probably damaging 1.00
R1882:Olfr1008 UTSW 2 85689606 missense probably damaging 1.00
R6573:Olfr1008 UTSW 2 85689999 missense probably damaging 0.99
R6640:Olfr1008 UTSW 2 85689935 missense probably damaging 1.00
R6746:Olfr1008 UTSW 2 85689608 missense probably damaging 1.00
R7045:Olfr1008 UTSW 2 85689911 missense possibly damaging 0.49
R7347:Olfr1008 UTSW 2 85689837 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCTCCCATAACTTGGAAGGATCTGAT -3'
(R):5'- GTAGGCGAGAGTCCAGCTTGGT -3'

Sequencing Primer
(F):5'- TCTCCTGGAAGAGATCATTTGC -3'
(R):5'- TCAGTGCTCTGTGTGATTCC -3'
Posted On2013-11-08