Incidental Mutation 'R0961:Rere'
ID81873
Institutional Source Beutler Lab
Gene Symbol Rere
Ensembl Gene ENSMUSG00000039852
Gene Namearginine glutamic acid dipeptide (RE) repeats
Synonyms1110033A15Rik, eyes3, Atr2, eye, atrophin-2
MMRRC Submission 039090-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0961 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location150281646-150621966 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 150615372 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000105680] [ENSMUST00000105682] [ENSMUST00000136646]
Predicted Effect unknown
Transcript: ENSMUST00000105680
AA Change: H703R
SMART Domains Protein: ENSMUSP00000101305
Gene: ENSMUSG00000039852
AA Change: H703R

DomainStartEndE-ValueType
ELM2 18 70 1.67e-13 SMART
SANT 124 173 1.8e-6 SMART
low complexity region 176 193 N/A INTRINSIC
ZnF_GATA 233 284 1.94e-15 SMART
Pfam:Atrophin-1 300 1290 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000105682
AA Change: H971R
SMART Domains Protein: ENSMUSP00000101307
Gene: ENSMUSG00000039852
AA Change: H971R

DomainStartEndE-ValueType
low complexity region 3 31 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
BAH 103 283 3.52e-13 SMART
ELM2 286 338 1.67e-13 SMART
SANT 392 441 1.8e-6 SMART
low complexity region 444 461 N/A INTRINSIC
ZnF_GATA 501 552 1.94e-15 SMART
Pfam:Atrophin-1 568 1557 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136646
SMART Domains Protein: ENSMUSP00000121544
Gene: ENSMUSG00000039852

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 199 2.2e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137112
Predicted Effect probably benign
Transcript: ENSMUST00000219467
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality with abnormalities in neural tube development, somite development, and in the embryonic heart. Mice homozygous for an ENU-induced allele exhibit narrow snouts, decreased body weight, renal agenesis and small eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Arhgap22 C T 14: 33,367,113 T352M probably damaging Het
Atg9a G A 1: 75,186,746 L237F probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Dmpk C G 7: 19,087,270 D204E probably damaging Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fam83b A T 9: 76,491,295 I842N probably damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fzd6 C T 15: 39,025,678 L64F probably damaging Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gbp7 C A 3: 142,541,557 S276* probably null Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Kdm2a A G 19: 4,329,191 V92A probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Lrig1 A G 6: 94,663,914 probably benign Het
Mep1b T A 18: 21,088,729 Y245* probably null Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr1008 A T 2: 85,689,446 T6S probably benign Het
Olfr130 T A 17: 38,067,923 Y251N probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Phactr4 A G 4: 132,378,420 S112P probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc10a5 T C 3: 10,334,424 H392R probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Spata31d1b T C 13: 59,717,804 V922A possibly damaging Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Usp18 G A 6: 121,261,493 A200T probably benign Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Rere
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Rere APN 4 150619463 missense probably damaging 1.00
IGL01465:Rere APN 4 150509994 missense unknown
IGL01523:Rere APN 4 150615555 missense possibly damaging 0.93
IGL01688:Rere APN 4 150618436 missense probably damaging 1.00
IGL02057:Rere APN 4 150614832 unclassified probably benign
IGL02621:Rere APN 4 150613812 unclassified probably benign
IGL02672:Rere APN 4 150510026 missense unknown
R0116:Rere UTSW 4 150616976 missense probably benign 0.18
R0119:Rere UTSW 4 150615322 unclassified probably benign
R0344:Rere UTSW 4 150610981 unclassified probably benign
R0504:Rere UTSW 4 150615322 unclassified probably benign
R0630:Rere UTSW 4 150619088 missense probably damaging 1.00
R1164:Rere UTSW 4 150534884 missense unknown
R1424:Rere UTSW 4 150617038 missense probably damaging 1.00
R1542:Rere UTSW 4 150615942 missense probably damaging 1.00
R1652:Rere UTSW 4 150612065 unclassified probably benign
R1953:Rere UTSW 4 150616837 missense probably damaging 1.00
R1959:Rere UTSW 4 150468790 missense probably benign 0.23
R1966:Rere UTSW 4 150616873 missense probably damaging 1.00
R1975:Rere UTSW 4 150615733 missense probably damaging 0.99
R2070:Rere UTSW 4 150614590 unclassified probably benign
R2115:Rere UTSW 4 150612561 unclassified probably benign
R2144:Rere UTSW 4 150616931 missense probably damaging 0.99
R2270:Rere UTSW 4 150477380 missense unknown
R2969:Rere UTSW 4 150570216 missense unknown
R3699:Rere UTSW 4 150477362 critical splice acceptor site probably null
R3723:Rere UTSW 4 150468795 missense probably damaging 1.00
R3826:Rere UTSW 4 150470328 missense probably benign 0.42
R4234:Rere UTSW 4 150617405 missense probably damaging 1.00
R4512:Rere UTSW 4 150477452 missense unknown
R4798:Rere UTSW 4 150615167 unclassified probably benign
R4883:Rere UTSW 4 150616053 missense probably damaging 0.98
R4914:Rere UTSW 4 150619144 missense probably damaging 1.00
R4916:Rere UTSW 4 150619144 missense probably damaging 1.00
R4917:Rere UTSW 4 150619144 missense probably damaging 1.00
R4918:Rere UTSW 4 150619144 missense probably damaging 1.00
R4966:Rere UTSW 4 150613816 unclassified probably benign
R5172:Rere UTSW 4 150570269 missense unknown
R5643:Rere UTSW 4 150617243 missense probably damaging 1.00
R6058:Rere UTSW 4 150468798 missense probably damaging 1.00
R7112:Rere UTSW 4 150406604 missense probably benign
R7173:Rere UTSW 4 150468738 missense probably damaging 1.00
R7190:Rere UTSW 4 150610953 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGCACCATACAGCTTCCAGCGTC -3'
(R):5'- CCTTGATTTGCACAGCAGGGAGTG -3'

Sequencing Primer
(F):5'- AAGGGAACAGCCCTTGC -3'
(R):5'- CCTCCAGGTACGAAAGGGTG -3'
Posted On2013-11-08