Incidental Mutation 'R0961:Fam83b'
ID81889
Institutional Source Beutler Lab
Gene Symbol Fam83b
Ensembl Gene ENSMUSG00000032358
Gene Namefamily with sequence similarity 83, member B
SynonymsC530008M07Rik
MMRRC Submission 039090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0961 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location76490054-76567116 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76491295 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 842 (I842N)
Ref Sequence ENSEMBL: ENSMUSP00000139354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098546] [ENSMUST00000183437]
Predicted Effect probably damaging
Transcript: ENSMUST00000098546
AA Change: I842N

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096146
Gene: ENSMUSG00000032358
AA Change: I842N

DomainStartEndE-ValueType
Pfam:DUF1669 12 282 5.6e-109 PFAM
Pfam:PLDc_2 139 277 2.4e-12 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183437
AA Change: I842N

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139354
Gene: ENSMUSG00000032358
AA Change: I842N

DomainStartEndE-ValueType
Pfam:DUF1669 7 283 2.8e-111 PFAM
Pfam:PLDc_2 139 277 2.4e-9 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Arhgap22 C T 14: 33,367,113 T352M probably damaging Het
Atg9a G A 1: 75,186,746 L237F probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Dmpk C G 7: 19,087,270 D204E probably damaging Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fzd6 C T 15: 39,025,678 L64F probably damaging Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gbp7 C A 3: 142,541,557 S276* probably null Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Kdm2a A G 19: 4,329,191 V92A probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Lrig1 A G 6: 94,663,914 probably benign Het
Mep1b T A 18: 21,088,729 Y245* probably null Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr1008 A T 2: 85,689,446 T6S probably benign Het
Olfr130 T A 17: 38,067,923 Y251N probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Phactr4 A G 4: 132,378,420 S112P probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Rere A G 4: 150,615,372 probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc10a5 T C 3: 10,334,424 H392R probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Spata31d1b T C 13: 59,717,804 V922A possibly damaging Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Usp18 G A 6: 121,261,493 A200T probably benign Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Fam83b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fam83b APN 9 76490978 missense probably benign 0.00
IGL01554:Fam83b APN 9 76502121 missense probably benign 0.33
IGL01694:Fam83b APN 9 76490990 missense probably benign 0.13
IGL02009:Fam83b APN 9 76492322 missense probably damaging 1.00
IGL02531:Fam83b APN 9 76492000 missense possibly damaging 0.61
IGL03328:Fam83b APN 9 76493042 missense probably benign 0.01
PIT4581001:Fam83b UTSW 9 76491152 missense probably damaging 1.00
R0110:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0469:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0510:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0732:Fam83b UTSW 9 76492928 nonsense probably null
R0946:Fam83b UTSW 9 76491397 missense probably damaging 0.96
R1101:Fam83b UTSW 9 76545670 missense possibly damaging 0.68
R1200:Fam83b UTSW 9 76492312 missense probably damaging 1.00
R1248:Fam83b UTSW 9 76503076 missense probably benign 0.35
R1420:Fam83b UTSW 9 76492612 missense possibly damaging 0.94
R1429:Fam83b UTSW 9 76492577 missense probably benign
R1939:Fam83b UTSW 9 76493080 missense probably damaging 1.00
R1992:Fam83b UTSW 9 76492022 missense probably benign
R2102:Fam83b UTSW 9 76492705 missense probably damaging 0.96
R2134:Fam83b UTSW 9 76491016 missense probably damaging 1.00
R2398:Fam83b UTSW 9 76502218 missense probably damaging 1.00
R2878:Fam83b UTSW 9 76490810 missense probably damaging 1.00
R4092:Fam83b UTSW 9 76491661 missense probably benign 0.24
R4204:Fam83b UTSW 9 76503053 missense probably benign 0.09
R4537:Fam83b UTSW 9 76492142 missense probably benign 0.10
R4920:Fam83b UTSW 9 76491868 missense probably benign
R5456:Fam83b UTSW 9 76492595 missense probably benign
R5473:Fam83b UTSW 9 76491500 missense probably damaging 1.00
R5488:Fam83b UTSW 9 76545599 missense probably benign 0.05
R5489:Fam83b UTSW 9 76545599 missense probably benign 0.05
R5876:Fam83b UTSW 9 76491850 missense possibly damaging 0.92
R6150:Fam83b UTSW 9 76492357 missense probably damaging 1.00
R6374:Fam83b UTSW 9 76492907 missense probably benign 0.31
R6468:Fam83b UTSW 9 76502131 nonsense probably null
R6912:Fam83b UTSW 9 76490932 missense probably damaging 0.99
R7022:Fam83b UTSW 9 76502112 frame shift probably null
R7073:Fam83b UTSW 9 76545749 missense probably benign 0.18
R7356:Fam83b UTSW 9 76492853 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGAGCTGATCTCCTTGGAATCCCG -3'
(R):5'- TGCTCAAAAGGCGCAGTTTCCC -3'

Sequencing Primer
(F):5'- GGAGAAGGCGCTATTCTTCT -3'
(R):5'- AGGTTATCGAGAGAGACCCTCC -3'
Posted On2013-11-08