Mutagenetix > Incidental Mutation

Incidental Mutation 'R0879:Stra6'

81929

Institutional Source

Beutler Lab

Gene Symbol

Stra6

Ensembl Gene

ENSMUSG00000032327

Gene Name

stimulated by retinoic acid gene 6

Synonyms

MMRRC Submission

039046-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R0879 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57971071-58061279 bp(+) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 58042487 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000130232 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034880] [ENSMUST00000085677] [ENSMUST00000085677] [ENSMUST00000128021] [ENSMUST00000128021] [ENSMUST00000128378] [ENSMUST00000128378] [ENSMUST00000133287] [ENSMUST00000133287] [ENSMUST00000134450] [ENSMUST00000134450] [ENSMUST00000134955] [ENSMUST00000134955] [ENSMUST00000136154] [ENSMUST00000136154] [ENSMUST00000136338] [ENSMUST00000136338] [ENSMUST00000147134] [ENSMUST00000147134] [ENSMUST00000150820] [ENSMUST00000150820] [ENSMUST00000167479] [ENSMUST00000167479] [ENSMUST00000170397] [ENSMUST00000170397]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000034880

SMART Domains

Protein: ENSMUSP00000034880
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	659	1.6e-253	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000085677

SMART Domains

Protein: ENSMUSP00000082820
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	41	658	1.9e-248	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000085677

SMART Domains

Protein: ENSMUSP00000082820
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	41	658	1.9e-248	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000128021

SMART Domains

Protein: ENSMUSP00000117832
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	87	8.1e-11	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000128021

SMART Domains

Protein: ENSMUSP00000117832
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	87	8.1e-11	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000128378

SMART Domains

Protein: ENSMUSP00000115511
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	164	4.7e-40	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000128378

SMART Domains

Protein: ENSMUSP00000115511
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	164	4.7e-40	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000133287

SMART Domains

Protein: ENSMUSP00000114346
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	138	3.4e-28	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000133287

SMART Domains

Protein: ENSMUSP00000114346
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	138	3.4e-28	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000134450

Predicted Effect

probably null
Transcript: ENSMUST00000134450

Predicted Effect

probably null
Transcript: ENSMUST00000134955

SMART Domains

Protein: ENSMUSP00000117280
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	190	1.3e-51	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000134955

SMART Domains

Protein: ENSMUSP00000117280
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	190	1.3e-51	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000136154

SMART Domains

Protein: ENSMUSP00000119062
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	199	1.7e-56	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000136154

SMART Domains

Protein: ENSMUSP00000119062
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	199	1.7e-56	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000136338

SMART Domains

Protein: ENSMUSP00000115314
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	99	4e-16	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000136338

SMART Domains

Protein: ENSMUSP00000115314
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	99	4e-16	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000147134

SMART Domains

Protein: ENSMUSP00000115315
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	162	6.2e-38	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000147134

SMART Domains

Protein: ENSMUSP00000115315
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	162	6.2e-38	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000150820

SMART Domains

Protein: ENSMUSP00000122373
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	168	1.9e-41	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000150820

SMART Domains

Protein: ENSMUSP00000122373
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	168	1.9e-41	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000167479

SMART Domains

Protein: ENSMUSP00000128417
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	659	1.6e-253	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000167479

SMART Domains

Protein: ENSMUSP00000128417
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	659	1.6e-253	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000170397

SMART Domains

Protein: ENSMUSP00000130232
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	659	1.6e-253	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000170397

SMART Domains

Protein: ENSMUSP00000130232
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	659	1.6e-253	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145886

Meta Mutation Damage Score

0.9482

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.9%
20x: 96.3%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in the metabolism of retinol. The encoded protein acts as a receptor for retinol/retinol binding protein complexes. This protein removes the retinol from the complex and transports it across the cell membrane. Defects in this gene are a cause of syndromic microphthalmia type 9 (MCOPS9). Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Male mice homozygous for a gene trap allele exhibit growth retardation. Mice homozygous for a knock-out allele exhibit persistent hyperplastic primary vitreous, shorter inner and outer segment and reduced rod and cone function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aagab	T	A	9: 63,524,892 (GRCm39)		probably benign	Het
Adm	A	G	7: 110,227,559 (GRCm39)	D25G	possibly damaging	Het
Adprs	C	T	4: 126,210,410 (GRCm39)	V357I	probably benign	Het
Akap6	G	T	12: 52,927,582 (GRCm39)	R164L	probably damaging	Het
Baz2a	A	G	10: 127,957,173 (GRCm39)	N972S	probably damaging	Het
Brd2	A	T	17: 34,332,420 (GRCm39)	V232D	probably benign	Het
C6	A	G	15: 4,792,818 (GRCm39)		probably benign	Het
Ceacam5	A	C	7: 17,491,627 (GRCm39)	I666L	probably benign	Het
Col7a1	T	C	9: 108,805,159 (GRCm39)		probably benign	Het
Dnah17	C	T	11: 117,947,661 (GRCm39)		probably benign	Het
Dnah7a	A	T	1: 53,467,019 (GRCm39)	V3615E	possibly damaging	Het
Eml6	A	G	11: 29,800,816 (GRCm39)		probably null	Het
Enpp2	T	C	15: 54,741,326 (GRCm39)	E324G	probably damaging	Het
Fgd4	A	G	16: 16,295,313 (GRCm39)	V222A	probably damaging	Het
Gm4076	A	G	13: 85,275,326 (GRCm39)		noncoding transcript	Het
Gm4775	T	C	14: 106,338,227 (GRCm39)		noncoding transcript	Het
Igsf9b	T	C	9: 27,245,038 (GRCm39)	S1002P	probably damaging	Het
Jag1	A	G	2: 136,942,001 (GRCm39)	S244P	possibly damaging	Het
Klhl41	A	T	2: 69,513,827 (GRCm39)		probably benign	Het
Ltbr	A	G	6: 125,290,338 (GRCm39)		probably benign	Het
Megf8	A	G	7: 25,037,896 (GRCm39)	E804G	possibly damaging	Het
Mybpc1	G	A	10: 88,407,378 (GRCm39)		probably benign	Het
Npas4	T	C	19: 5,036,944 (GRCm39)	R407G	probably benign	Het
Oxnad1	T	A	14: 31,821,553 (GRCm39)	Y213N	probably damaging	Het
Pde6d	A	G	1: 86,473,523 (GRCm39)	F91S	probably benign	Het
Pelp1	A	G	11: 70,286,123 (GRCm39)		probably benign	Het
Plscr2	T	C	9: 92,169,846 (GRCm39)	Y99H	probably damaging	Het
Rft1	T	C	14: 30,404,705 (GRCm39)		probably benign	Het
Ryr3	T	C	2: 112,860,588 (GRCm39)	Y30C	probably benign	Het
Selenbp2	A	G	3: 94,606,863 (GRCm39)	T108A	possibly damaging	Het
Stk32b	A	G	5: 37,616,940 (GRCm39)		probably benign	Het
Usp17le	A	T	7: 104,418,854 (GRCm39)	L96Q	probably damaging	Het
Usp17le	G	T	7: 104,418,855 (GRCm39)	L96M	possibly damaging	Het
Vmn1r76	A	T	7: 11,664,662 (GRCm39)	I184N	probably benign	Het
Vmn2r102	T	C	17: 19,914,454 (GRCm39)	V673A	probably damaging	Het
Wdr17	T	G	8: 55,114,516 (GRCm39)	I667L	probably benign	Het
Zfp292	T	C	4: 34,811,218 (GRCm39)	T609A	probably benign	Het
Zfp821	T	C	8: 110,448,474 (GRCm39)	I135T	possibly damaging	Het
Zfp865	A	G	7: 5,034,342 (GRCm39)	T776A	probably benign	Het
Zp2	G	T	7: 119,734,757 (GRCm39)	P477Q	probably damaging	Het

Other mutations in Stra6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Stra6	APN	9	58,059,854 (GRCm39)	missense	probably benign	0.01
IGL01885:Stra6	APN	9	58,048,431 (GRCm39)	missense	probably damaging	1.00
IGL02219:Stra6	APN	9	58,047,752 (GRCm39)	missense	probably benign	0.18
IGL02550:Stra6	APN	9	58,057,366 (GRCm39)	missense	possibly damaging	0.95
IGL02745:Stra6	APN	9	58,059,321 (GRCm39)	missense	probably damaging	1.00
IGL02999:Stra6	APN	9	58,042,396 (GRCm39)	missense	probably benign	0.19
R0034:Stra6	UTSW	9	58,058,752 (GRCm39)	splice site	probably null
R0070:Stra6	UTSW	9	58,059,898 (GRCm39)	splice site	probably benign
R0070:Stra6	UTSW	9	58,059,898 (GRCm39)	splice site	probably benign
R0281:Stra6	UTSW	9	58,052,772 (GRCm39)	missense	probably benign	0.11
R0387:Stra6	UTSW	9	58,060,466 (GRCm39)	missense	probably benign	0.13
R1075:Stra6	UTSW	9	58,058,687 (GRCm39)	missense	possibly damaging	0.79
R1605:Stra6	UTSW	9	58,059,166 (GRCm39)	missense	probably benign
R1840:Stra6	UTSW	9	58,047,813 (GRCm39)	missense	probably benign	0.00
R1896:Stra6	UTSW	9	58,059,166 (GRCm39)	missense	probably benign
R2149:Stra6	UTSW	9	58,059,822 (GRCm39)	missense	probably benign	0.01
R4016:Stra6	UTSW	9	58,042,473 (GRCm39)	missense	probably damaging	0.99
R4127:Stra6	UTSW	9	58,058,501 (GRCm39)	missense	probably damaging	1.00
R4243:Stra6	UTSW	9	58,050,309 (GRCm39)	missense	probably benign	0.06
R4631:Stra6	UTSW	9	58,048,115 (GRCm39)	intron	probably benign
R4671:Stra6	UTSW	9	58,056,517 (GRCm39)	missense	probably benign	0.01
R4688:Stra6	UTSW	9	58,042,359 (GRCm39)	critical splice acceptor site	probably null
R5091:Stra6	UTSW	9	58,048,429 (GRCm39)	missense	probably damaging	1.00
R6179:Stra6	UTSW	9	58,042,452 (GRCm39)	missense	probably damaging	1.00
R6486:Stra6	UTSW	9	58,058,705 (GRCm39)	frame shift	probably null
R6593:Stra6	UTSW	9	58,059,262 (GRCm39)	missense	probably benign	0.00
R7368:Stra6	UTSW	9	58,058,543 (GRCm39)	missense	probably benign	0.03
R7395:Stra6	UTSW	9	58,048,380 (GRCm39)	missense	probably damaging	1.00
R7503:Stra6	UTSW	9	58,058,528 (GRCm39)	missense	possibly damaging	0.70
R7807:Stra6	UTSW	9	58,057,444 (GRCm39)	missense	probably damaging	0.97
R8099:Stra6	UTSW	9	58,059,777 (GRCm39)	missense	probably damaging	1.00
R8377:Stra6	UTSW	9	58,056,488 (GRCm39)	missense	probably damaging	1.00
R8780:Stra6	UTSW	9	58,042,254 (GRCm39)	intron	probably benign
R8817:Stra6	UTSW	9	58,059,265 (GRCm39)	missense	possibly damaging	0.94
R9117:Stra6	UTSW	9	58,059,822 (GRCm39)	missense	probably benign	0.01
R9495:Stra6	UTSW	9	58,059,175 (GRCm39)	missense	probably benign	0.03
R9582:Stra6	UTSW	9	58,054,770 (GRCm39)	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TCAAGAGAAGACTCCTGTCTGCCC -3'
(R):5'- TGACTCTCCCATGCCTGTAAAGCC -3'

Sequencing Primer
(F):5'- AAATGttcctttgtttcttcttcttc -3'
(R):5'- aagaactgttgtccccagg -3'

Posted On

2013-11-08