Incidental Mutation 'R0943:Fam72a'
ID81949
Institutional Source Beutler Lab
Gene Symbol Fam72a
Ensembl Gene ENSMUSG00000055184
Gene Namefamily with sequence similarity 72, member A
SynonymsP17, 2700049P18Rik
MMRRC Submission 039082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R0943 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location131527903-131539872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131528779 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 27 (S27P)
Ref Sequence ENSEMBL: ENSMUSP00000068111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068613] [ENSMUST00000097588] [ENSMUST00000186543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068613
AA Change: S27P

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068111
Gene: ENSMUSG00000055184
AA Change: S27P

DomainStartEndE-ValueType
Pfam:FAM72 5 149 3.9e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097588
SMART Domains Protein: ENSMUSP00000095195
Gene: ENSMUSG00000026425

DomainStartEndE-ValueType
FCH 22 120 7.33e-18 SMART
low complexity region 178 191 N/A INTRINSIC
coiled coil region 363 401 N/A INTRINSIC
Blast:RhoGAP 445 490 7e-12 BLAST
RhoGAP 502 676 9.6e-60 SMART
SH3 731 786 4.52e-15 SMART
low complexity region 852 868 N/A INTRINSIC
coiled coil region 940 967 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186543
SMART Domains Protein: ENSMUSP00000139405
Gene: ENSMUSG00000026425

DomainStartEndE-ValueType
FCH 22 120 3.7e-20 SMART
low complexity region 178 191 N/A INTRINSIC
coiled coil region 363 401 N/A INTRINSIC
Blast:RhoGAP 445 490 7e-12 BLAST
RhoGAP 502 676 5.9e-62 SMART
SH3 731 786 2.8e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189893
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C T 2: 85,488,765 D398N probably damaging Het
A230050P20Rik A T 9: 20,872,962 H160L possibly damaging Het
Agtpbp1 T C 13: 59,500,602 N468S probably benign Het
Card6 A G 15: 5,100,286 S543P probably damaging Het
Celsr1 T G 15: 85,903,288 T2750P probably damaging Het
Csmd3 A G 15: 47,675,739 M2341T probably damaging Het
Dym A G 18: 75,286,769 *670W probably null Het
Ehbp1 T C 11: 22,095,883 D597G probably benign Het
Emx1 G A 6: 85,203,919 W206* probably null Het
Esr1 A G 10: 4,746,781 K210R probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fanca A T 8: 123,274,186 C1152S probably damaging Het
Fras1 G A 5: 96,726,543 V2276I probably benign Het
Gm9008 T C 6: 76,496,415 H406R probably benign Het
Hoxb13 A G 11: 96,195,973 E202G probably benign Het
Lcmt1 T G 7: 123,401,439 probably null Het
Mettl7a1 T C 15: 100,304,958 Y20H probably benign Het
Nars2 C T 7: 96,955,931 probably benign Het
Neil3 ATATTTATTTATTTATTTATTTATTTATTTATT ATATTTATTTATTTATTTATTTATTTATTTATTTATT 8: 53,609,369 probably benign Het
Nup153 T C 13: 46,696,772 probably benign Het
Olfr1257 T C 2: 89,880,961 V45A probably benign Het
Olfr1466 C A 19: 13,341,793 H12N probably benign Het
Prkar2a T C 9: 108,733,276 probably benign Het
Ptprc T C 1: 138,111,164 T209A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rprd2 C T 3: 95,784,247 V239I possibly damaging Het
Sgo2b A G 8: 63,931,335 F209S possibly damaging Het
Spry2 T C 14: 105,893,587 Y55C probably damaging Het
Tbc1d32 A T 10: 56,161,147 V667E probably benign Het
Tbrg4 A G 11: 6,619,008 F388L probably damaging Het
Tshz1 T C 18: 84,015,231 T351A probably benign Het
Usp48 A G 4: 137,644,470 N969S possibly damaging Het
Vmn2r108 A T 17: 20,471,135 C375* probably null Het
Vps45 T A 3: 96,057,024 I62F probably benign Het
Xab2 A G 8: 3,613,667 F388L probably benign Het
Zfp735 A G 11: 73,712,083 T618A probably benign Het
Zswim2 T A 2: 83,917,998 R279S possibly damaging Het
Other mutations in Fam72a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01619:Fam72a APN 1 131533912 missense probably benign 0.01
R0548:Fam72a UTSW 1 131533861 missense probably damaging 1.00
R1037:Fam72a UTSW 1 131533819 missense probably damaging 1.00
R1728:Fam72a UTSW 1 131530668 missense probably benign 0.00
R1728:Fam72a UTSW 1 131538895 missense probably benign 0.00
R1729:Fam72a UTSW 1 131530668 missense probably benign 0.00
R1729:Fam72a UTSW 1 131538895 missense probably benign 0.00
R1730:Fam72a UTSW 1 131530668 missense probably benign 0.00
R1730:Fam72a UTSW 1 131538895 missense probably benign 0.00
R1739:Fam72a UTSW 1 131530668 missense probably benign 0.00
R1739:Fam72a UTSW 1 131538895 missense probably benign 0.00
R1762:Fam72a UTSW 1 131530668 missense probably benign 0.00
R1762:Fam72a UTSW 1 131538895 missense probably benign 0.00
R1783:Fam72a UTSW 1 131530668 missense probably benign 0.00
R1783:Fam72a UTSW 1 131538895 missense probably benign 0.00
R1784:Fam72a UTSW 1 131530668 missense probably benign 0.00
R1784:Fam72a UTSW 1 131538895 missense probably benign 0.00
R1785:Fam72a UTSW 1 131530668 missense probably benign 0.00
R1785:Fam72a UTSW 1 131538895 missense probably benign 0.00
R2508:Fam72a UTSW 1 131528854 critical splice donor site probably null
R6589:Fam72a UTSW 1 131533816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTGAATCCTACGAAGAAGCCGC -3'
(R):5'- TGTCCAGACAGTCTGCCCACTTAG -3'

Sequencing Primer
(F):5'- GTTTCCCTTTCCACCAGGAAAATAG -3'
(R):5'- TCCAAGGGAATCATCAGACTG -3'
Posted On2013-11-08