Incidental Mutation 'R0943:Zswim2'
ID81952
Institutional Source Beutler Lab
Gene Symbol Zswim2
Ensembl Gene ENSMUSG00000034552
Gene Namezinc finger SWIM-type containing 2
Synonyms4933437F18Rik, MEX, 1700025P14Rik
MMRRC Submission 039082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R0943 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location83915079-83941228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83917998 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 279 (R279S)
Ref Sequence ENSEMBL: ENSMUSP00000044913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038223] [ENSMUST00000152829]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038223
AA Change: R279S

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044913
Gene: ENSMUSG00000034552
AA Change: R279S

DomainStartEndE-ValueType
Pfam:SWIM 54 87 1.4e-7 PFAM
RING 147 198 8.3e-5 SMART
ZnF_ZZ 229 273 1.8e-5 SMART
RING 344 385 1.3e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000152829
AA Change: R279S

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119439
Gene: ENSMUSG00000034552
AA Change: R279S

DomainStartEndE-ValueType
Pfam:SWIM 54 87 1.6e-10 PFAM
RING 147 198 1.69e-2 SMART
ZnF_ZZ 229 273 3.65e-3 SMART
Blast:RING 344 365 3e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155127
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C T 2: 85,488,765 D398N probably damaging Het
A230050P20Rik A T 9: 20,872,962 H160L possibly damaging Het
Agtpbp1 T C 13: 59,500,602 N468S probably benign Het
Card6 A G 15: 5,100,286 S543P probably damaging Het
Celsr1 T G 15: 85,903,288 T2750P probably damaging Het
Csmd3 A G 15: 47,675,739 M2341T probably damaging Het
Dym A G 18: 75,286,769 *670W probably null Het
Ehbp1 T C 11: 22,095,883 D597G probably benign Het
Emx1 G A 6: 85,203,919 W206* probably null Het
Esr1 A G 10: 4,746,781 K210R probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam72a T C 1: 131,528,779 S27P possibly damaging Het
Fanca A T 8: 123,274,186 C1152S probably damaging Het
Fras1 G A 5: 96,726,543 V2276I probably benign Het
Gm9008 T C 6: 76,496,415 H406R probably benign Het
Hoxb13 A G 11: 96,195,973 E202G probably benign Het
Lcmt1 T G 7: 123,401,439 probably null Het
Mettl7a1 T C 15: 100,304,958 Y20H probably benign Het
Nars2 C T 7: 96,955,931 probably benign Het
Neil3 ATATTTATTTATTTATTTATTTATTTATTTATT ATATTTATTTATTTATTTATTTATTTATTTATTTATT 8: 53,609,369 probably benign Het
Nup153 T C 13: 46,696,772 probably benign Het
Olfr1257 T C 2: 89,880,961 V45A probably benign Het
Olfr1466 C A 19: 13,341,793 H12N probably benign Het
Prkar2a T C 9: 108,733,276 probably benign Het
Ptprc T C 1: 138,111,164 T209A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rprd2 C T 3: 95,784,247 V239I possibly damaging Het
Sgo2b A G 8: 63,931,335 F209S possibly damaging Het
Spry2 T C 14: 105,893,587 Y55C probably damaging Het
Tbc1d32 A T 10: 56,161,147 V667E probably benign Het
Tbrg4 A G 11: 6,619,008 F388L probably damaging Het
Tshz1 T C 18: 84,015,231 T351A probably benign Het
Usp48 A G 4: 137,644,470 N969S possibly damaging Het
Vmn2r108 A T 17: 20,471,135 C375* probably null Het
Vps45 T A 3: 96,057,024 I62F probably benign Het
Xab2 A G 8: 3,613,667 F388L probably benign Het
Zfp735 A G 11: 73,712,083 T618A probably benign Het
Other mutations in Zswim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Zswim2 APN 2 83923771 missense probably benign 0.00
IGL01140:Zswim2 APN 2 83915328 missense probably benign 0.06
IGL01362:Zswim2 APN 2 83915346 missense probably benign 0.09
IGL01768:Zswim2 APN 2 83917957 missense probably benign 0.00
IGL02166:Zswim2 APN 2 83915406 nonsense probably null
IGL02187:Zswim2 APN 2 83923638 missense probably damaging 0.98
IGL02239:Zswim2 APN 2 83938763 nonsense probably null
IGL02629:Zswim2 APN 2 83925209 missense possibly damaging 0.94
R0609:Zswim2 UTSW 2 83923659 missense probably benign 0.02
R0946:Zswim2 UTSW 2 83923759 missense probably benign 0.10
R1006:Zswim2 UTSW 2 83915393 missense probably damaging 0.97
R1191:Zswim2 UTSW 2 83923695 missense possibly damaging 0.60
R1309:Zswim2 UTSW 2 83938756 missense probably damaging 1.00
R1549:Zswim2 UTSW 2 83923748 missense probably benign 0.24
R1563:Zswim2 UTSW 2 83915282 missense possibly damaging 0.71
R1739:Zswim2 UTSW 2 83915340 nonsense probably null
R1994:Zswim2 UTSW 2 83915663 missense possibly damaging 0.95
R4039:Zswim2 UTSW 2 83915994 missense probably damaging 1.00
R4645:Zswim2 UTSW 2 83915547 missense probably benign 0.00
R4738:Zswim2 UTSW 2 83915395 missense probably benign 0.16
R4855:Zswim2 UTSW 2 83916843 critical splice donor site probably null
R4933:Zswim2 UTSW 2 83925227 missense probably damaging 1.00
R4963:Zswim2 UTSW 2 83925110 missense probably damaging 1.00
R5153:Zswim2 UTSW 2 83939666 missense possibly damaging 0.75
R5401:Zswim2 UTSW 2 83925245 missense possibly damaging 0.94
R5698:Zswim2 UTSW 2 83925183 missense possibly damaging 0.92
R6002:Zswim2 UTSW 2 83915688 missense probably damaging 0.98
R6396:Zswim2 UTSW 2 83923718 missense probably damaging 1.00
R6447:Zswim2 UTSW 2 83915113 unclassified probably null
R6646:Zswim2 UTSW 2 83915784 nonsense probably null
R6717:Zswim2 UTSW 2 83915409 missense probably benign 0.02
R6735:Zswim2 UTSW 2 83923761 missense probably benign 0.04
R6830:Zswim2 UTSW 2 83939684 missense probably damaging 1.00
R7056:Zswim2 UTSW 2 83920748 critical splice acceptor site probably null
R7088:Zswim2 UTSW 2 83915727 nonsense probably null
R7383:Zswim2 UTSW 2 83915328 missense possibly damaging 0.95
R7440:Zswim2 UTSW 2 83920719 missense probably damaging 1.00
X0018:Zswim2 UTSW 2 83941094 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTGAGTGGGCTGACACAAGACC -3'
(R):5'- GCCATTCTAGTAAACCCACAGCAGG -3'

Sequencing Primer
(F):5'- tgacacaagacccttgcc -3'
(R):5'- CCCACAGCAGGATGTGAG -3'
Posted On2013-11-08