Incidental Mutation 'R0943:Nars2'
ID81963
Institutional Source Beutler Lab
Gene Symbol Nars2
Ensembl Gene ENSMUSG00000018995
Gene Nameasparaginyl-tRNA synthetase 2 (mitochondrial)(putative)
Synonyms
MMRRC Submission 039082-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R0943 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location96951505-97064758 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 96955931 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044466] [ENSMUST00000107159]
Predicted Effect probably benign
Transcript: ENSMUST00000044466
SMART Domains Protein: ENSMUSP00000044937
Gene: ENSMUSG00000018995

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:tRNA_anti-codon 44 118 2.4e-12 PFAM
Pfam:tRNA-synt_2 135 472 1.4e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107159
SMART Domains Protein: ENSMUSP00000102777
Gene: ENSMUSG00000018995

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:tRNA_anti-codon 44 118 7.6e-14 PFAM
Pfam:tRNA-synt_2 135 390 5.4e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149204
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of asparagine to tRNA molecules. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency 24 (COXPD24). [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C T 2: 85,488,765 D398N probably damaging Het
A230050P20Rik A T 9: 20,872,962 H160L possibly damaging Het
Agtpbp1 T C 13: 59,500,602 N468S probably benign Het
Card6 A G 15: 5,100,286 S543P probably damaging Het
Celsr1 T G 15: 85,903,288 T2750P probably damaging Het
Csmd3 A G 15: 47,675,739 M2341T probably damaging Het
Dym A G 18: 75,286,769 *670W probably null Het
Ehbp1 T C 11: 22,095,883 D597G probably benign Het
Emx1 G A 6: 85,203,919 W206* probably null Het
Esr1 A G 10: 4,746,781 K210R probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam72a T C 1: 131,528,779 S27P possibly damaging Het
Fanca A T 8: 123,274,186 C1152S probably damaging Het
Fras1 G A 5: 96,726,543 V2276I probably benign Het
Gm9008 T C 6: 76,496,415 H406R probably benign Het
Hoxb13 A G 11: 96,195,973 E202G probably benign Het
Lcmt1 T G 7: 123,401,439 probably null Het
Mettl7a1 T C 15: 100,304,958 Y20H probably benign Het
Neil3 ATATTTATTTATTTATTTATTTATTTATTTATT ATATTTATTTATTTATTTATTTATTTATTTATTTATT 8: 53,609,369 probably benign Het
Nup153 T C 13: 46,696,772 probably benign Het
Olfr1257 T C 2: 89,880,961 V45A probably benign Het
Olfr1466 C A 19: 13,341,793 H12N probably benign Het
Prkar2a T C 9: 108,733,276 probably benign Het
Ptprc T C 1: 138,111,164 T209A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rprd2 C T 3: 95,784,247 V239I possibly damaging Het
Sgo2b A G 8: 63,931,335 F209S possibly damaging Het
Spry2 T C 14: 105,893,587 Y55C probably damaging Het
Tbc1d32 A T 10: 56,161,147 V667E probably benign Het
Tbrg4 A G 11: 6,619,008 F388L probably damaging Het
Tshz1 T C 18: 84,015,231 T351A probably benign Het
Usp48 A G 4: 137,644,470 N969S possibly damaging Het
Vmn2r108 A T 17: 20,471,135 C375* probably null Het
Vps45 T A 3: 96,057,024 I62F probably benign Het
Xab2 A G 8: 3,613,667 F388L probably benign Het
Zfp735 A G 11: 73,712,083 T618A probably benign Het
Zswim2 T A 2: 83,917,998 R279S possibly damaging Het
Other mutations in Nars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Nars2 APN 7 97031579 missense probably benign 0.00
IGL00796:Nars2 APN 7 97031580 missense probably benign 0.40
IGL00990:Nars2 APN 7 97002790 splice site probably benign
IGL02954:Nars2 APN 7 97039893 splice site probably null
IGL03256:Nars2 APN 7 97039910 missense possibly damaging 0.67
IGL03394:Nars2 APN 7 97040013 missense possibly damaging 0.94
R0600:Nars2 UTSW 7 97039923 missense probably damaging 1.00
R1389:Nars2 UTSW 7 97002829 missense probably benign
R4076:Nars2 UTSW 7 96958094 missense probably damaging 0.99
R4397:Nars2 UTSW 7 96973564 critical splice donor site probably null
R4758:Nars2 UTSW 7 96973528 missense probably damaging 1.00
R4771:Nars2 UTSW 7 97035245 missense probably damaging 1.00
R4908:Nars2 UTSW 7 97023741 missense probably benign 0.07
R5162:Nars2 UTSW 7 97059820 utr 3 prime probably benign
R6209:Nars2 UTSW 7 97057521 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTTCAggagagatggctctgtg -3'
(R):5'- ggcagaggaTACCAGCATGTGAAAA -3'

Sequencing Primer
(F):5'- cctttgttttcctttgttttgttttg -3'
(R):5'- aggaTACCAGCATGTGAAAATGTTAG -3'
Posted On2013-11-08