Incidental Mutation 'R0943:Lcmt1'
ID81964
Institutional Source Beutler Lab
Gene Symbol Lcmt1
Ensembl Gene ENSMUSG00000030763
Gene Nameleucine carboxyl methyltransferase 1
SynonymsLCMT-1, Lcmt
MMRRC Submission 039082-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0943 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location123369784-123430358 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 123401439 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033025] [ENSMUST00000206574] [ENSMUST00000206721]
Predicted Effect probably null
Transcript: ENSMUST00000033025
SMART Domains Protein: ENSMUSP00000033025
Gene: ENSMUSG00000030763

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:LCM 23 215 3.6e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000206574
Predicted Effect probably null
Transcript: ENSMUST00000206721
Meta Mutation Damage Score 0.6264 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LCMT1 catalyzes the methylation of the carboxyl group of the C-terminal leucine residue (leu309) of the catalytic subunit of protein phosphatase-2A (PPP2CA; MIM 176915) (De Baere et al., 1999 [PubMed 10600115]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele are embryonic lethal. Mice homozygous for a hypomorphic gene trap allele exhibit partial embryonic lethality, insulin resistance and impaired glucose tolerance. Mice homozygous for a transgenic gene disruption exhibit kidney agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C T 2: 85,488,765 D398N probably damaging Het
A230050P20Rik A T 9: 20,872,962 H160L possibly damaging Het
Agtpbp1 T C 13: 59,500,602 N468S probably benign Het
Card6 A G 15: 5,100,286 S543P probably damaging Het
Celsr1 T G 15: 85,903,288 T2750P probably damaging Het
Csmd3 A G 15: 47,675,739 M2341T probably damaging Het
Dym A G 18: 75,286,769 *670W probably null Het
Ehbp1 T C 11: 22,095,883 D597G probably benign Het
Emx1 G A 6: 85,203,919 W206* probably null Het
Esr1 A G 10: 4,746,781 K210R probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam72a T C 1: 131,528,779 S27P possibly damaging Het
Fanca A T 8: 123,274,186 C1152S probably damaging Het
Fras1 G A 5: 96,726,543 V2276I probably benign Het
Gm9008 T C 6: 76,496,415 H406R probably benign Het
Hoxb13 A G 11: 96,195,973 E202G probably benign Het
Mettl7a1 T C 15: 100,304,958 Y20H probably benign Het
Nars2 C T 7: 96,955,931 probably benign Het
Neil3 ATATTTATTTATTTATTTATTTATTTATTTATT ATATTTATTTATTTATTTATTTATTTATTTATTTATT 8: 53,609,369 probably benign Het
Nup153 T C 13: 46,696,772 probably benign Het
Olfr1257 T C 2: 89,880,961 V45A probably benign Het
Olfr1466 C A 19: 13,341,793 H12N probably benign Het
Prkar2a T C 9: 108,733,276 probably benign Het
Ptprc T C 1: 138,111,164 T209A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rprd2 C T 3: 95,784,247 V239I possibly damaging Het
Sgo2b A G 8: 63,931,335 F209S possibly damaging Het
Spry2 T C 14: 105,893,587 Y55C probably damaging Het
Tbc1d32 A T 10: 56,161,147 V667E probably benign Het
Tbrg4 A G 11: 6,619,008 F388L probably damaging Het
Tshz1 T C 18: 84,015,231 T351A probably benign Het
Usp48 A G 4: 137,644,470 N969S possibly damaging Het
Vmn2r108 A T 17: 20,471,135 C375* probably null Het
Vps45 T A 3: 96,057,024 I62F probably benign Het
Xab2 A G 8: 3,613,667 F388L probably benign Het
Zfp735 A G 11: 73,712,083 T618A probably benign Het
Zswim2 T A 2: 83,917,998 R279S possibly damaging Het
Other mutations in Lcmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Lcmt1 APN 7 123428153 missense probably damaging 1.00
IGL01536:Lcmt1 APN 7 123422743 missense possibly damaging 0.46
IGL01564:Lcmt1 APN 7 123404440 missense probably benign 0.00
IGL02598:Lcmt1 APN 7 123421648 splice site probably benign
R0665:Lcmt1 UTSW 7 123402871 missense probably damaging 1.00
R0668:Lcmt1 UTSW 7 123402871 missense probably damaging 1.00
R1574:Lcmt1 UTSW 7 123402908 missense probably damaging 1.00
R1574:Lcmt1 UTSW 7 123402908 missense probably damaging 1.00
R2896:Lcmt1 UTSW 7 123421586 missense possibly damaging 0.95
R3017:Lcmt1 UTSW 7 123430136 missense probably damaging 1.00
R3547:Lcmt1 UTSW 7 123400479 missense probably benign 0.07
R3714:Lcmt1 UTSW 7 123404460 missense probably damaging 0.98
R4092:Lcmt1 UTSW 7 123418253 missense probably damaging 1.00
R4628:Lcmt1 UTSW 7 123410812 nonsense probably null
R5062:Lcmt1 UTSW 7 123410830 splice site probably null
R5096:Lcmt1 UTSW 7 123401468 missense probably damaging 1.00
R5549:Lcmt1 UTSW 7 123428107 missense probably damaging 1.00
R5573:Lcmt1 UTSW 7 123401463 missense probably benign 0.03
R5931:Lcmt1 UTSW 7 123421616 missense probably benign
R6331:Lcmt1 UTSW 7 123378182 intron probably benign
Predicted Primers PCR Primer
(F):5'- GGCTTACTTTTGCCCCAGTGAAAAC -3'
(R):5'- GAGTTGAGAGTTGTCAAAACACAGCAC -3'

Sequencing Primer
(F):5'- AGATAGTCTCTGTGAGCAATGC -3'
(R):5'- gacccacctgtctgccc -3'
Posted On2013-11-08