Incidental Mutation 'R0943:Hoxb13'
ID81976
Institutional Source Beutler Lab
Gene Symbol Hoxb13
Ensembl Gene ENSMUSG00000049604
Gene Namehomeobox B13
Synonyms
MMRRC Submission 039082-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0943 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location96194316-96197447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96195973 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 202 (E202G)
Ref Sequence ENSEMBL: ENSMUSP00000056315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062709]
Predicted Effect probably benign
Transcript: ENSMUST00000062709
AA Change: E202G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056315
Gene: ENSMUSG00000049604
AA Change: E202G

DomainStartEndE-ValueType
Pfam:HoxA13_N 12 124 9.2e-31 PFAM
HOX 218 280 5.62e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184648
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that belongs to the homeobox gene family. Genes of this family are highly conserved among vertebrates and essential for vertebrate embryonic development. This gene has been implicated to play a role in fetal skin development and cutaneous regeneration. In mice, a similar gene was shown to exhibit temporal and spatial colinearity in the main body axis of the embryo, but was not expressed in the secondary axes, which suggests functions in body patterning along the axis. This gene and other HOXB genes form a gene cluster at chromosome the 17q21-22 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for loss of function mutations show overgrowth in all major structures derived from the tail bud. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C T 2: 85,488,765 D398N probably damaging Het
A230050P20Rik A T 9: 20,872,962 H160L possibly damaging Het
Agtpbp1 T C 13: 59,500,602 N468S probably benign Het
Card6 A G 15: 5,100,286 S543P probably damaging Het
Celsr1 T G 15: 85,903,288 T2750P probably damaging Het
Csmd3 A G 15: 47,675,739 M2341T probably damaging Het
Dym A G 18: 75,286,769 *670W probably null Het
Ehbp1 T C 11: 22,095,883 D597G probably benign Het
Emx1 G A 6: 85,203,919 W206* probably null Het
Esr1 A G 10: 4,746,781 K210R probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam72a T C 1: 131,528,779 S27P possibly damaging Het
Fanca A T 8: 123,274,186 C1152S probably damaging Het
Fras1 G A 5: 96,726,543 V2276I probably benign Het
Gm9008 T C 6: 76,496,415 H406R probably benign Het
Lcmt1 T G 7: 123,401,439 probably null Het
Mettl7a1 T C 15: 100,304,958 Y20H probably benign Het
Nars2 C T 7: 96,955,931 probably benign Het
Neil3 ATATTTATTTATTTATTTATTTATTTATTTATT ATATTTATTTATTTATTTATTTATTTATTTATTTATT 8: 53,609,369 probably benign Het
Nup153 T C 13: 46,696,772 probably benign Het
Olfr1257 T C 2: 89,880,961 V45A probably benign Het
Olfr1466 C A 19: 13,341,793 H12N probably benign Het
Prkar2a T C 9: 108,733,276 probably benign Het
Ptprc T C 1: 138,111,164 T209A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rprd2 C T 3: 95,784,247 V239I possibly damaging Het
Sgo2b A G 8: 63,931,335 F209S possibly damaging Het
Spry2 T C 14: 105,893,587 Y55C probably damaging Het
Tbc1d32 A T 10: 56,161,147 V667E probably benign Het
Tbrg4 A G 11: 6,619,008 F388L probably damaging Het
Tshz1 T C 18: 84,015,231 T351A probably benign Het
Usp48 A G 4: 137,644,470 N969S possibly damaging Het
Vmn2r108 A T 17: 20,471,135 C375* probably null Het
Vps45 T A 3: 96,057,024 I62F probably benign Het
Xab2 A G 8: 3,613,667 F388L probably benign Het
Zfp735 A G 11: 73,712,083 T618A probably benign Het
Zswim2 T A 2: 83,917,998 R279S possibly damaging Het
Other mutations in Hoxb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Hoxb13 APN 11 96194642 missense possibly damaging 0.79
IGL02005:Hoxb13 APN 11 96194609 missense probably damaging 1.00
IGL02973:Hoxb13 APN 11 96194843 missense probably damaging 1.00
R4573:Hoxb13 UTSW 11 96194951 missense probably damaging 1.00
R4658:Hoxb13 UTSW 11 96194483 missense probably benign 0.19
R6976:Hoxb13 UTSW 11 96196218 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAATCAGGCAGAATCTAGGGCTGTG -3'
(R):5'- GGCAAGAACCTTCTTCTCCTTGACC -3'

Sequencing Primer
(F):5'- AATCTAGGGCTGTGTGCTTTGAG -3'
(R):5'- CGGTTCTGAAACCAGATGGTAATC -3'
Posted On2013-11-08