Incidental Mutation 'R0944:Ints2'
ID82017
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Nameintegrator complex subunit 2
Synonyms2810417D08Rik
MMRRC Submission 039083-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R0944 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86210681-86257575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86244463 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 375 (V375A)
Ref Sequence ENSEMBL: ENSMUSP00000103674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018212
AA Change: V375A

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: V375A

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108039
AA Change: V375A

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: V375A

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik G A 12: 107,489,009 R118K unknown Het
Abcc6 T A 7: 46,015,505 I301F possibly damaging Het
Akap9 C A 5: 4,064,742 probably null Het
Alg6 A G 4: 99,762,060 I506V probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Camk1 A G 6: 113,338,391 Y105H probably damaging Het
Ccdc81 T C 7: 89,866,569 N634S probably damaging Het
Clcn1 C A 6: 42,313,141 Q837K probably benign Het
Clec16a A G 16: 10,688,646 probably benign Het
Col22a1 T C 15: 71,881,662 I130V probably benign Het
Coro2b T C 9: 62,427,981 S308G probably benign Het
Cpxm1 A G 2: 130,397,503 W2R probably damaging Het
Csmd3 T C 15: 47,611,831 N3364S probably damaging Het
Dgkq A G 5: 108,656,465 V131A probably damaging Het
Dnaic1 A G 4: 41,629,997 S469G probably benign Het
Eml4 G A 17: 83,478,060 E885K probably benign Het
Etfa A T 9: 55,488,838 I148N probably damaging Het
Gm11639 T G 11: 104,710,730 probably null Het
Gpbar1 A G 1: 74,279,522 D308G probably benign Het
Gprin3 T C 6: 59,353,915 E469G possibly damaging Het
Igkv1-115 T C 6: 68,161,683 V90A probably damaging Het
Mindy3 T C 2: 12,396,182 M242V possibly damaging Het
Olfr1094 A C 2: 86,828,937 I62L probably benign Het
Olfr279 A G 15: 98,497,684 I71V probably benign Het
Olfr353 T C 2: 36,890,686 H54R probably damaging Het
P3h1 G A 4: 119,238,759 E355K probably benign Het
Paxbp1 T C 16: 91,023,427 T703A probably benign Het
Pcdh15 A T 10: 74,210,470 Y193F probably damaging Het
Pdxdc1 A G 16: 13,838,369 V613A probably damaging Het
Plekha5 T C 6: 140,570,196 probably benign Het
Pmel A T 10: 128,715,257 Q123L possibly damaging Het
Prl6a1 T C 13: 27,318,166 probably benign Het
Rcan1 T C 16: 92,393,491 T187A probably damaging Het
Rp1l1 A G 14: 64,032,232 S1756G probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc5 T C 13: 92,661,105 Y39H probably damaging Het
Sgsm1 G A 5: 113,265,874 T676I probably benign Het
Slc6a15 G C 10: 103,409,796 V547L probably benign Het
Slk T C 19: 47,608,993 I80T probably damaging Het
Spice1 A G 16: 44,384,761 N810S probably benign Het
Spred2 A G 11: 20,001,104 probably benign Het
Tbc1d4 C G 14: 101,479,220 probably benign Het
Tdrd7 G A 4: 46,029,762 V1032M probably benign Het
Tlr11 A G 14: 50,362,336 N593S probably benign Het
Trpa1 T C 1: 14,912,361 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp25 T C 16: 77,081,447 probably benign Het
Vmn2r97 T A 17: 18,947,403 S640T probably benign Het
Zc3h6 A G 2: 129,006,816 Y321C probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86233135 missense probably damaging 1.00
IGL02490:Ints2 APN 11 86233183 missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86215578 missense probably damaging 1.00
IGL03396:Ints2 APN 11 86213062 missense probably damaging 0.99
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0355:Ints2 UTSW 11 86234749 missense probably benign 0.00
R0389:Ints2 UTSW 11 86248851 missense probably damaging 1.00
R0631:Ints2 UTSW 11 86233196 missense probably benign 0.02
R1268:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1269:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1270:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1396:Ints2 UTSW 11 86249248 missense probably damaging 0.98
R1474:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1503:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1840:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1987:Ints2 UTSW 11 86217800 missense probably benign 0.03
R1990:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86243001 missense probably benign 0.41
R4056:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4057:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4569:Ints2 UTSW 11 86256198 missense probably damaging 1.00
R4585:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4586:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4806:Ints2 UTSW 11 86256209 missense probably benign 0.10
R4929:Ints2 UTSW 11 86212653 missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86256200 missense probably damaging 1.00
R5064:Ints2 UTSW 11 86249274 missense probably damaging 1.00
R5270:Ints2 UTSW 11 86215795 missense probably damaging 1.00
R5621:Ints2 UTSW 11 86242947 missense probably benign 0.32
R5875:Ints2 UTSW 11 86238312 missense probably benign 0.04
R5908:Ints2 UTSW 11 86215545 critical splice donor site probably null
R5914:Ints2 UTSW 11 86222174 missense probably benign 0.03
R5941:Ints2 UTSW 11 86250972 missense probably benign 0.01
R5975:Ints2 UTSW 11 86226748 missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86238468 missense probably damaging 1.00
R6091:Ints2 UTSW 11 86236603 missense probably damaging 0.96
R6209:Ints2 UTSW 11 86225058 missense probably damaging 1.00
R6567:Ints2 UTSW 11 86226661 missense probably benign 0.42
R6764:Ints2 UTSW 11 86212779 missense probably benign 0.00
R7033:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R7132:Ints2 UTSW 11 86217754 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TTTCCTTCAACTGGGGCTCAGGAC -3'
(R):5'- AGGCTCCTCATGTTGGGTCAACTG -3'

Sequencing Primer
(F):5'- TCACAGGACCTTTATACACTGGG -3'
(R):5'- GTGACAAGATCCATTCAGCTTC -3'
Posted On2013-11-08