Incidental Mutation 'R0944:Gm11639'
ID82018
Institutional Source Beutler Lab
Gene Symbol Gm11639
Ensembl Gene ENSMUSG00000040838
Gene Namepredicted gene 11639
Synonyms
MMRRC Submission 039083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R0944 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104685707-105117394 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to G at 104710730 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148007] [ENSMUST00000148007] [ENSMUST00000212287] [ENSMUST00000212287] [ENSMUST00000212287] [ENSMUST00000212287]
Predicted Effect probably null
Transcript: ENSMUST00000148007
SMART Domains Protein: ENSMUSP00000116040
Gene: ENSMUSG00000040838

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
internal_repeat_4 146 233 3.42e-6 PROSPERO
internal_repeat_3 165 247 2.21e-6 PROSPERO
low complexity region 331 348 N/A INTRINSIC
internal_repeat_2 349 361 4.38e-8 PROSPERO
internal_repeat_2 371 383 4.38e-8 PROSPERO
low complexity region 385 640 N/A INTRINSIC
Pfam:EF-hand_8 677 729 8.7e-6 PFAM
low complexity region 835 842 N/A INTRINSIC
internal_repeat_1 879 1106 2.47e-14 PROSPERO
internal_repeat_4 1015 1108 3.42e-6 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000148007
SMART Domains Protein: ENSMUSP00000116040
Gene: ENSMUSG00000040838

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
internal_repeat_4 146 233 3.42e-6 PROSPERO
internal_repeat_3 165 247 2.21e-6 PROSPERO
low complexity region 331 348 N/A INTRINSIC
internal_repeat_2 349 361 4.38e-8 PROSPERO
internal_repeat_2 371 383 4.38e-8 PROSPERO
low complexity region 385 640 N/A INTRINSIC
Pfam:EF-hand_8 677 729 8.7e-6 PFAM
low complexity region 835 842 N/A INTRINSIC
internal_repeat_1 879 1106 2.47e-14 PROSPERO
internal_repeat_4 1015 1108 3.42e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175713
Predicted Effect probably null
Transcript: ENSMUST00000212287
Predicted Effect probably null
Transcript: ENSMUST00000212287
Predicted Effect probably null
Transcript: ENSMUST00000212287
Predicted Effect probably null
Transcript: ENSMUST00000212287
Meta Mutation Damage Score 0.6528 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik G A 12: 107,489,009 R118K unknown Het
Abcc6 T A 7: 46,015,505 I301F possibly damaging Het
Akap9 C A 5: 4,064,742 probably null Het
Alg6 A G 4: 99,762,060 I506V probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Camk1 A G 6: 113,338,391 Y105H probably damaging Het
Ccdc81 T C 7: 89,866,569 N634S probably damaging Het
Clcn1 C A 6: 42,313,141 Q837K probably benign Het
Clec16a A G 16: 10,688,646 probably benign Het
Col22a1 T C 15: 71,881,662 I130V probably benign Het
Coro2b T C 9: 62,427,981 S308G probably benign Het
Cpxm1 A G 2: 130,397,503 W2R probably damaging Het
Csmd3 T C 15: 47,611,831 N3364S probably damaging Het
Dgkq A G 5: 108,656,465 V131A probably damaging Het
Dnaic1 A G 4: 41,629,997 S469G probably benign Het
Eml4 G A 17: 83,478,060 E885K probably benign Het
Etfa A T 9: 55,488,838 I148N probably damaging Het
Gpbar1 A G 1: 74,279,522 D308G probably benign Het
Gprin3 T C 6: 59,353,915 E469G possibly damaging Het
Igkv1-115 T C 6: 68,161,683 V90A probably damaging Het
Ints2 A G 11: 86,244,463 V375A possibly damaging Het
Mindy3 T C 2: 12,396,182 M242V possibly damaging Het
Olfr1094 A C 2: 86,828,937 I62L probably benign Het
Olfr279 A G 15: 98,497,684 I71V probably benign Het
Olfr353 T C 2: 36,890,686 H54R probably damaging Het
P3h1 G A 4: 119,238,759 E355K probably benign Het
Paxbp1 T C 16: 91,023,427 T703A probably benign Het
Pcdh15 A T 10: 74,210,470 Y193F probably damaging Het
Pdxdc1 A G 16: 13,838,369 V613A probably damaging Het
Plekha5 T C 6: 140,570,196 probably benign Het
Pmel A T 10: 128,715,257 Q123L possibly damaging Het
Prl6a1 T C 13: 27,318,166 probably benign Het
Rcan1 T C 16: 92,393,491 T187A probably damaging Het
Rp1l1 A G 14: 64,032,232 S1756G probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc5 T C 13: 92,661,105 Y39H probably damaging Het
Sgsm1 G A 5: 113,265,874 T676I probably benign Het
Slc6a15 G C 10: 103,409,796 V547L probably benign Het
Slk T C 19: 47,608,993 I80T probably damaging Het
Spice1 A G 16: 44,384,761 N810S probably benign Het
Spred2 A G 11: 20,001,104 probably benign Het
Tbc1d4 C G 14: 101,479,220 probably benign Het
Tdrd7 G A 4: 46,029,762 V1032M probably benign Het
Tlr11 A G 14: 50,362,336 N593S probably benign Het
Trpa1 T C 1: 14,912,361 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp25 T C 16: 77,081,447 probably benign Het
Vmn2r97 T A 17: 18,947,403 S640T probably benign Het
Zc3h6 A G 2: 129,006,816 Y321C probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Gm11639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gm11639 APN 11 105100021 missense probably damaging 1.00
IGL01308:Gm11639 APN 11 104720697 missense probably benign 0.03
IGL01483:Gm11639 APN 11 104739347 missense probably benign 0.03
IGL01695:Gm11639 APN 11 104736063 missense probably damaging 1.00
IGL01860:Gm11639 APN 11 104690921 missense probably benign 0.16
IGL01981:Gm11639 APN 11 104721432 intron probably benign
IGL01984:Gm11639 APN 11 104738308 missense probably benign 0.20
IGL02023:Gm11639 APN 11 104721432 intron probably benign
IGL02252:Gm11639 APN 11 104753927 missense possibly damaging 0.68
IGL02886:Gm11639 APN 11 105095874 missense possibly damaging 0.95
IGL03116:Gm11639 APN 11 104721533 missense probably benign 0.02
IGL03141:Gm11639 APN 11 105095870 missense probably damaging 0.99
IGL03242:Gm11639 APN 11 105106404 missense probably damaging 1.00
IGL03274:Gm11639 APN 11 104721093 missense probably benign 0.03
IGL03408:Gm11639 APN 11 104710621 missense probably benign 0.03
R0018:Gm11639 UTSW 11 104721552 critical splice donor site probably null
R0068:Gm11639 UTSW 11 104720822 missense probably benign 0.29
R0350:Gm11639 UTSW 11 104690880 missense probably benign 0.03
R0646:Gm11639 UTSW 11 104720501 missense probably benign 0.03
R0668:Gm11639 UTSW 11 104720492 missense probably benign 0.16
R0715:Gm11639 UTSW 11 104720880 missense possibly damaging 0.90
R1330:Gm11639 UTSW 11 104746290 missense possibly damaging 0.84
R1508:Gm11639 UTSW 11 104710677 missense probably benign 0.03
R1643:Gm11639 UTSW 11 104698978 missense probably benign 0.16
R1651:Gm11639 UTSW 11 104720666 missense probably benign 0.03
R1665:Gm11639 UTSW 11 104721114 missense probably benign 0.07
R1702:Gm11639 UTSW 11 104691006 missense probably benign 0.03
R1711:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1779:Gm11639 UTSW 11 104720939 missense probably benign 0.15
R1813:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1818:Gm11639 UTSW 11 104721507 missense probably benign 0.10
R1896:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1969:Gm11639 UTSW 11 104746264 missense probably damaging 1.00
R2139:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R2165:Gm11639 UTSW 11 104751862 missense possibly damaging 0.93
R2359:Gm11639 UTSW 11 104739280 missense possibly damaging 0.80
R2394:Gm11639 UTSW 11 104738295 missense probably benign 0.17
R2406:Gm11639 UTSW 11 104720631 missense probably benign 0.03
R2570:Gm11639 UTSW 11 104733664 missense probably damaging 1.00
R3795:Gm11639 UTSW 11 104733675 missense possibly damaging 0.94
R4352:Gm11639 UTSW 11 104739314 missense probably null 0.25
R4359:Gm11639 UTSW 11 104733721 splice site probably null
R4424:Gm11639 UTSW 11 104736114 critical splice donor site probably null
R4895:Gm11639 UTSW 11 104720286 missense probably benign 0.16
R4895:Gm11639 UTSW 11 104749670 missense probably damaging 1.00
R5006:Gm11639 UTSW 11 104729677 splice site probably null
R5066:Gm11639 UTSW 11 104720664 missense probably benign 0.03
R5329:Gm11639 UTSW 11 104753806 intron probably null
R5405:Gm11639 UTSW 11 104721192 missense probably benign 0.07
R5814:Gm11639 UTSW 11 104736114 critical splice donor site probably benign
R5888:Gm11639 UTSW 11 104721401 splice site probably benign
R5910:Gm11639 UTSW 11 104690934 missense probably benign 0.01
R5975:Gm11639 UTSW 11 104687549 start gained probably benign
R6019:Gm11639 UTSW 11 105042902 critical splice donor site probably null
R6028:Gm11639 UTSW 11 104769655 critical splice donor site probably null
R6048:Gm11639 UTSW 11 104944433 missense unknown
R6059:Gm11639 UTSW 11 105036769 missense probably benign 0.03
R6147:Gm11639 UTSW 11 104967740 missense unknown
R6176:Gm11639 UTSW 11 104792557 missense probably benign 0.16
R6181:Gm11639 UTSW 11 104831333 missense probably benign 0.25
R6196:Gm11639 UTSW 11 104855560 missense probably benign 0.07
R6245:Gm11639 UTSW 11 104785008 missense probably benign 0.03
R6262:Gm11639 UTSW 11 104893753 missense probably benign 0.24
R6263:Gm11639 UTSW 11 104919486 missense unknown
R6277:Gm11639 UTSW 11 105010322 missense possibly damaging 0.49
R6338:Gm11639 UTSW 11 104843208 nonsense probably null
R6355:Gm11639 UTSW 11 105005685 missense probably benign 0.29
R6356:Gm11639 UTSW 11 104893707 missense probably benign 0.19
R6365:Gm11639 UTSW 11 104924586 missense unknown
R6391:Gm11639 UTSW 11 104994317 missense possibly damaging 0.92
R6556:Gm11639 UTSW 11 105008251 missense probably null 0.03
R6604:Gm11639 UTSW 11 104698946 nonsense probably null
R6605:Gm11639 UTSW 11 104999281 splice site probably null
R6634:Gm11639 UTSW 11 104893783 missense probably benign 0.17
R6851:Gm11639 UTSW 11 105005695 missense probably benign 0.03
R6862:Gm11639 UTSW 11 104721458 nonsense probably null
R6949:Gm11639 UTSW 11 104909070 missense probably damaging 1.00
R6970:Gm11639 UTSW 11 104776356 missense probably benign 0.03
R7014:Gm11639 UTSW 11 104693422 missense probably benign 0.03
R7097:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7122:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7124:Gm11639 UTSW 11 104738274 missense probably benign 0.17
R7146:Gm11639 UTSW 11 104967752 missense unknown
R7146:Gm11639 UTSW 11 105022938 missense probably benign 0.03
R7154:Gm11639 UTSW 11 104699140 intron probably null
R7175:Gm11639 UTSW 11 104947411 missense unknown
R7198:Gm11639 UTSW 11 104751885 missense probably benign 0.15
R7211:Gm11639 UTSW 11 104710713 missense probably benign 0.01
R7211:Gm11639 UTSW 11 104724609 critical splice donor site probably null
R7216:Gm11639 UTSW 11 104880549 missense possibly damaging 0.49
R7221:Gm11639 UTSW 11 104900606 missense probably benign 0.36
R7233:Gm11639 UTSW 11 104839843 missense possibly damaging 0.69
R7236:Gm11639 UTSW 11 104899267 missense probably benign 0.10
R7262:Gm11639 UTSW 11 104854606 critical splice donor site probably null
R7289:Gm11639 UTSW 11 105038358 missense probably benign 0.24
R7323:Gm11639 UTSW 11 105030011 missense probably benign 0.07
R7378:Gm11639 UTSW 11 104714702 missense probably benign 0.03
R7388:Gm11639 UTSW 11 104721045 missense probably damaging 0.97
R7390:Gm11639 UTSW 11 104724585 missense possibly damaging 0.46
R7411:Gm11639 UTSW 11 104999723 missense probably benign 0.10
R7468:Gm11639 UTSW 11 104749700 missense probably benign 0.17
R7497:Gm11639 UTSW 11 104762690 critical splice donor site probably null
X0026:Gm11639 UTSW 11 104720975 missense probably benign 0.07
Z1088:Gm11639 UTSW 11 104751902 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGGGTAACCTTTTCCTCACTAGGTGAC -3'
(R):5'- TGTAGAACATTCTCGTGTGTCTTCCAC -3'

Sequencing Primer
(F):5'- CTCACTAGGTGACTGGTACGAAATC -3'
(R):5'- ACGCTGATTTTTTTTTATGCCG -3'
Posted On2013-11-08