Incidental Mutation 'R0944:Rcan1'
ID82033
Institutional Source Beutler Lab
Gene Symbol Rcan1
Ensembl Gene ENSMUSG00000022951
Gene Nameregulator of calcineurin 1
SynonymsMCIP1, 2410048A02Rik, ADAPT78, Dscr1, CSP1
MMRRC Submission 039083-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0944 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location92391953-92470867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92393491 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 187 (T187A)
Ref Sequence ENSEMBL: ENSMUSP00000023672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023672] [ENSMUST00000060005] [ENSMUST00000231410] [ENSMUST00000231813] [ENSMUST00000232197] [ENSMUST00000232239]
Predicted Effect probably damaging
Transcript: ENSMUST00000023672
AA Change: T187A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023672
Gene: ENSMUSG00000022951
AA Change: T187A

DomainStartEndE-ValueType
Pfam:Calcipressin 20 192 1.2e-62 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000060005
AA Change: T240A
SMART Domains Protein: ENSMUSP00000060394
Gene: ENSMUSG00000022951
AA Change: T240A

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
low complexity region 39 46 N/A INTRINSIC
Pfam:Calcipressin 73 245 3.8e-65 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000231410
AA Change: T107A
Predicted Effect unknown
Transcript: ENSMUST00000231813
AA Change: T48A
Predicted Effect unknown
Transcript: ENSMUST00000232197
AA Change: T107A
Predicted Effect unknown
Transcript: ENSMUST00000232239
AA Change: T187A
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with calcineurin A and inhibits calcineurin-dependent signaling pathways, possibly affecting central nervous system development. This gene is located in the minimal candidate region for the Down syndrome phenotype, and is overexpressed in the brain of Down syndrome fetuses. Chronic overexpression of this gene may lead to neurofibrillary tangles such as those associated with Alzheimer disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Unstressed homozygous mutant mice show no overt phenotype other than a slight reduction in heart size and an impaired T helper 1 response. Stress-induced cardiac hypertrophy, however, is attenuated in mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik G A 12: 107,489,009 R118K unknown Het
Abcc6 T A 7: 46,015,505 I301F possibly damaging Het
Akap9 C A 5: 4,064,742 probably null Het
Alg6 A G 4: 99,762,060 I506V probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Camk1 A G 6: 113,338,391 Y105H probably damaging Het
Ccdc81 T C 7: 89,866,569 N634S probably damaging Het
Clcn1 C A 6: 42,313,141 Q837K probably benign Het
Clec16a A G 16: 10,688,646 probably benign Het
Col22a1 T C 15: 71,881,662 I130V probably benign Het
Coro2b T C 9: 62,427,981 S308G probably benign Het
Cpxm1 A G 2: 130,397,503 W2R probably damaging Het
Csmd3 T C 15: 47,611,831 N3364S probably damaging Het
Dgkq A G 5: 108,656,465 V131A probably damaging Het
Dnaic1 A G 4: 41,629,997 S469G probably benign Het
Eml4 G A 17: 83,478,060 E885K probably benign Het
Etfa A T 9: 55,488,838 I148N probably damaging Het
Gm11639 T G 11: 104,710,730 probably null Het
Gpbar1 A G 1: 74,279,522 D308G probably benign Het
Gprin3 T C 6: 59,353,915 E469G possibly damaging Het
Igkv1-115 T C 6: 68,161,683 V90A probably damaging Het
Ints2 A G 11: 86,244,463 V375A possibly damaging Het
Mindy3 T C 2: 12,396,182 M242V possibly damaging Het
Olfr1094 A C 2: 86,828,937 I62L probably benign Het
Olfr279 A G 15: 98,497,684 I71V probably benign Het
Olfr353 T C 2: 36,890,686 H54R probably damaging Het
P3h1 G A 4: 119,238,759 E355K probably benign Het
Paxbp1 T C 16: 91,023,427 T703A probably benign Het
Pcdh15 A T 10: 74,210,470 Y193F probably damaging Het
Pdxdc1 A G 16: 13,838,369 V613A probably damaging Het
Plekha5 T C 6: 140,570,196 probably benign Het
Pmel A T 10: 128,715,257 Q123L possibly damaging Het
Prl6a1 T C 13: 27,318,166 probably benign Het
Rp1l1 A G 14: 64,032,232 S1756G probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc5 T C 13: 92,661,105 Y39H probably damaging Het
Sgsm1 G A 5: 113,265,874 T676I probably benign Het
Slc6a15 G C 10: 103,409,796 V547L probably benign Het
Slk T C 19: 47,608,993 I80T probably damaging Het
Spice1 A G 16: 44,384,761 N810S probably benign Het
Spred2 A G 11: 20,001,104 probably benign Het
Tbc1d4 C G 14: 101,479,220 probably benign Het
Tdrd7 G A 4: 46,029,762 V1032M probably benign Het
Tlr11 A G 14: 50,362,336 N593S probably benign Het
Trpa1 T C 1: 14,912,361 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp25 T C 16: 77,081,447 probably benign Het
Vmn2r97 T A 17: 18,947,403 S640T probably benign Het
Zc3h6 A G 2: 129,006,816 Y321C probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Rcan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0973:Rcan1 UTSW 16 92393520 missense probably benign 0.04
R2303:Rcan1 UTSW 16 92393596 missense possibly damaging 0.80
R2340:Rcan1 UTSW 16 92397352 missense probably damaging 1.00
R3907:Rcan1 UTSW 16 92466029 utr 5 prime probably benign
R4352:Rcan1 UTSW 16 92393496 missense probably benign 0.11
R4857:Rcan1 UTSW 16 92465906 missense possibly damaging 0.77
R6072:Rcan1 UTSW 16 92465927 missense probably benign 0.01
R6991:Rcan1 UTSW 16 92397363 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TCAGTGAATGGCCCAAGACAGTCC -3'
(R):5'- GAGAGCAATTCTGCGGTGCAAATG -3'

Sequencing Primer
(F):5'- GACTCTCTTCTGAGCATCATGAAC -3'
(R):5'- CTCCATGCTCAGGGACAAG -3'
Posted On2013-11-08