Incidental Mutation 'R0945:Apoa2'
ID82039
Institutional Source Beutler Lab
Gene Symbol Apoa2
Ensembl Gene ENSMUSG00000005681
Gene Nameapolipoprotein A-II
SynonymsApoA-II, Hdl-1, Alp-2, Apoa-2
MMRRC Submission 039084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R0945 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171225054-171226379 bp(+) (GRCm38)
Type of Mutationunclassified (4998 bp from exon)
DNA Base Change (assembly) A to G at 171225699 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005817] [ENSMUST00000005824] [ENSMUST00000079957] [ENSMUST00000111319] [ENSMUST00000111320] [ENSMUST00000111321] [ENSMUST00000111326] [ENSMUST00000111327] [ENSMUST00000138184] [ENSMUST00000143405] [ENSMUST00000147246] [ENSMUST00000155126] [ENSMUST00000193973]
Predicted Effect probably benign
Transcript: ENSMUST00000005817
SMART Domains Protein: ENSMUSP00000005817
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 302 7.2e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000005824
AA Change: D29G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000005824
Gene: ENSMUSG00000005681
AA Change: D29G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 99 4.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079957
SMART Domains Protein: ENSMUSP00000078875
Gene: ENSMUSG00000058715

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:TCR_zetazeta 21 51 3.7e-19 PFAM
ITAM 62 82 9.62e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111319
AA Change: D29G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106951
Gene: ENSMUSG00000005681
AA Change: D29G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 98 2.1e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111320
AA Change: D29G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106952
Gene: ENSMUSG00000005681
AA Change: D29G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 99 4.2e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111321
AA Change: D29G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106953
Gene: ENSMUSG00000005681
AA Change: D29G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 99 4.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111326
SMART Domains Protein: ENSMUSP00000106958
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 95 9e-16 PFAM
Pfam:Porin_3 85 268 1.4e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111327
SMART Domains Protein: ENSMUSP00000106959
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 302 3.4e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130529
Predicted Effect probably benign
Transcript: ENSMUST00000138184
SMART Domains Protein: ENSMUSP00000115877
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 119 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143405
Predicted Effect probably benign
Transcript: ENSMUST00000147246
SMART Domains Protein: ENSMUSP00000119006
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 91 5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154106
Predicted Effect probably null
Transcript: ENSMUST00000155126
SMART Domains Protein: ENSMUSP00000137683
Gene: ENSMUSG00000005677

DomainStartEndE-ValueType
HOLI 36 196 5.55e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193973
SMART Domains Protein: ENSMUSP00000141240
Gene: ENSMUSG00000058715

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:TCR_zetazeta 21 53 4.7e-19 PFAM
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.1%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: This gene encodes a component of high density lipoproteins (HDL). Mice lacking the encoded protein have low HDL-cholesterol levels, smaller HDL particles, increased clearance of triglyceride-rich lipoproteins and insulin hypersensitivity. Transgenic mice overexpressing the encoded protein have elevated levels of HDL-cholesterol and show increased susceptibility to atherosclerosis. Alternative splicing of this gene results in multiple variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous null mutation of this gene results in a reduction of total cholesterol, HDL cholesterol, free fatty acids, insulin, and glucose levels in both the fasted and unfasted states. Strain specific alleles have been associated with varying degrees of amyloidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 A G 16: 35,290,111 M883V probably benign Het
Allc A G 12: 28,559,963 S212P probably benign Het
Anxa10 A G 8: 62,060,245 probably benign Het
Arfgef2 T C 2: 166,826,969 probably benign Het
Arhgap30 G T 1: 171,403,286 V204L probably damaging Het
Cd109 T A 9: 78,688,941 V852E possibly damaging Het
Ceacam5 T A 7: 17,747,344 Y339N probably damaging Het
Chaf1a A G 17: 56,067,441 D876G probably damaging Het
Chd9 A G 8: 90,933,002 K197E possibly damaging Het
Cnr2 A T 4: 135,917,321 M237L probably benign Het
Dnm2 C A 9: 21,505,660 Q830K probably damaging Het
Dst T C 1: 34,271,419 L1615P probably damaging Het
Eid1 A G 2: 125,673,577 D129G probably damaging Het
Exoc5 A G 14: 49,039,342 probably benign Het
Greb1 T C 12: 16,673,802 Y1854C probably benign Het
Il15ra T A 2: 11,718,327 V54E probably damaging Het
Il4i1 G A 7: 44,839,704 V306M probably damaging Het
Lrsam1 T C 2: 32,947,909 D211G probably benign Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Myrfl C T 10: 116,803,394 probably benign Het
Nell1 A G 7: 50,219,585 I203V probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr112 G A 17: 37,563,387 T308I probably benign Het
Olfr1234 T C 2: 89,363,255 Y58C probably damaging Het
Olfr654 T A 7: 104,588,672 N289K probably damaging Het
Pdxdc1 A G 16: 13,857,432 L345P probably damaging Het
Pex3 C A 10: 13,542,676 A79S probably benign Het
Pla2r1 A C 2: 60,458,410 L626R possibly damaging Het
Plcb3 A G 19: 6,954,878 S1107P probably damaging Het
Ppcdc C T 9: 57,420,158 probably null Het
Rbak A T 5: 143,173,579 F573Y probably damaging Het
Rfc1 A G 5: 65,278,709 probably null Het
Rpl13 C T 8: 123,105,174 A203V possibly damaging Het
Scn8a A G 15: 101,015,787 H1020R possibly damaging Het
Slf1 A G 13: 77,103,471 probably benign Het
Synj1 A G 16: 90,960,445 L905S possibly damaging Het
Tmem59 T A 4: 107,187,725 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uri1 A T 7: 37,969,678 D127E probably damaging Het
Usp31 T C 7: 121,670,253 E489G probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp941 C T 7: 140,811,664 R594H probably damaging Het
Zfy1 T C Y: 725,983 D594G probably damaging Het
Other mutations in Apoa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0833:Apoa2 UTSW 1 171225379 unclassified probably benign
R0836:Apoa2 UTSW 1 171225379 unclassified probably benign
R2230:Apoa2 UTSW 1 171225771 missense probably benign 0.00
R4866:Apoa2 UTSW 1 171225800 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCATCAACCAGTGGACTCAACAG -3'
(R):5'- TCCCCAAGTTAAGCCTGAGCATCC -3'

Sequencing Primer
(F):5'- GTGGACTCAACAGGAAGATTATTCTC -3'
(R):5'- AACCCCTGAGTTAAGATTCCTGG -3'
Posted On2013-11-08