Incidental Mutation 'R0945:Cnr2'
ID82051
Institutional Source Beutler Lab
Gene Symbol Cnr2
Ensembl Gene ENSMUSG00000062585
Gene Namecannabinoid receptor 2 (macrophage)
Synonymscannabinoid receptor 2 (spleen), CB2, CB2-R
MMRRC Submission 039084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0945 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location135895394-135920207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135917321 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 237 (M237L)
Ref Sequence ENSEMBL: ENSMUSP00000095454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030434] [ENSMUST00000068830] [ENSMUST00000097843]
Predicted Effect probably benign
Transcript: ENSMUST00000030434
SMART Domains Protein: ENSMUSP00000030434
Gene: ENSMUSG00000028673

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Alpha_L_fucos 22 399 7.97e-234 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068830
AA Change: M237L

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000069957
Gene: ENSMUSG00000062585
AA Change: M237L

DomainStartEndE-ValueType
Pfam:7tm_1 50 299 1.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097843
AA Change: M237L

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000095454
Gene: ENSMUSG00000062585
AA Change: M237L

DomainStartEndE-ValueType
Pfam:7tm_1 50 299 8e-37 PFAM
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.1%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cannabinoid delta-9-tetrahydrocannabinol is the principal psychoactive ingredient of marijuana. The proteins encoded by this gene and the cannabinoid receptor 1 (brain) (CNR1) gene have the characteristics of a guanine nucleotide-binding protein (G-protein)-coupled receptor for cannabinoids. They inhibit adenylate cyclase activity in a dose-dependent, stereoselective, and pertussis toxin-sensitive manner. These proteins have been found to be involved in the cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana. The cannabinoid receptors are members of family 1 of the G-protein-coupled receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Macrophages from homozygous mutant animals are resistant to the inhibitory effects of delta9-Tetrahydrocannabinol. Alopecia is seen in some but not all homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 A G 16: 35,290,111 M883V probably benign Het
Allc A G 12: 28,559,963 S212P probably benign Het
Anxa10 A G 8: 62,060,245 probably benign Het
Apoa2 A G 1: 171,225,699 probably null Het
Arfgef2 T C 2: 166,826,969 probably benign Het
Arhgap30 G T 1: 171,403,286 V204L probably damaging Het
Cd109 T A 9: 78,688,941 V852E possibly damaging Het
Ceacam5 T A 7: 17,747,344 Y339N probably damaging Het
Chaf1a A G 17: 56,067,441 D876G probably damaging Het
Chd9 A G 8: 90,933,002 K197E possibly damaging Het
Dnm2 C A 9: 21,505,660 Q830K probably damaging Het
Dst T C 1: 34,271,419 L1615P probably damaging Het
Eid1 A G 2: 125,673,577 D129G probably damaging Het
Exoc5 A G 14: 49,039,342 probably benign Het
Greb1 T C 12: 16,673,802 Y1854C probably benign Het
Il15ra T A 2: 11,718,327 V54E probably damaging Het
Il4i1 G A 7: 44,839,704 V306M probably damaging Het
Lrsam1 T C 2: 32,947,909 D211G probably benign Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Myrfl C T 10: 116,803,394 probably benign Het
Nell1 A G 7: 50,219,585 I203V probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr112 G A 17: 37,563,387 T308I probably benign Het
Olfr1234 T C 2: 89,363,255 Y58C probably damaging Het
Olfr654 T A 7: 104,588,672 N289K probably damaging Het
Pdxdc1 A G 16: 13,857,432 L345P probably damaging Het
Pex3 C A 10: 13,542,676 A79S probably benign Het
Pla2r1 A C 2: 60,458,410 L626R possibly damaging Het
Plcb3 A G 19: 6,954,878 S1107P probably damaging Het
Ppcdc C T 9: 57,420,158 probably null Het
Rbak A T 5: 143,173,579 F573Y probably damaging Het
Rfc1 A G 5: 65,278,709 probably null Het
Rpl13 C T 8: 123,105,174 A203V possibly damaging Het
Scn8a A G 15: 101,015,787 H1020R possibly damaging Het
Slf1 A G 13: 77,103,471 probably benign Het
Synj1 A G 16: 90,960,445 L905S possibly damaging Het
Tmem59 T A 4: 107,187,725 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uri1 A T 7: 37,969,678 D127E probably damaging Het
Usp31 T C 7: 121,670,253 E489G probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp941 C T 7: 140,811,664 R594H probably damaging Het
Zfy1 T C Y: 725,983 D594G probably damaging Het
Other mutations in Cnr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01990:Cnr2 APN 4 135916805 missense probably damaging 1.00
IGL02233:Cnr2 APN 4 135917211 missense possibly damaging 0.76
IGL02887:Cnr2 APN 4 135917625 missense possibly damaging 0.90
PIT4791001:Cnr2 UTSW 4 135916952 missense probably damaging 1.00
R0480:Cnr2 UTSW 4 135917601 missense probably benign 0.00
R0616:Cnr2 UTSW 4 135917562 missense probably benign 0.39
R1242:Cnr2 UTSW 4 135916983 missense probably damaging 1.00
R1538:Cnr2 UTSW 4 135916701 missense probably benign 0.00
R4330:Cnr2 UTSW 4 135916926 missense possibly damaging 0.56
R4911:Cnr2 UTSW 4 135917201 missense possibly damaging 0.88
R4960:Cnr2 UTSW 4 135917607 missense probably benign 0.01
R5289:Cnr2 UTSW 4 135917007 missense probably damaging 1.00
R5642:Cnr2 UTSW 4 135916765 missense probably damaging 1.00
R5681:Cnr2 UTSW 4 135916689 missense probably damaging 0.99
R5807:Cnr2 UTSW 4 135917436 missense probably benign 0.00
R6843:Cnr2 UTSW 4 135917589 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGGGTCCTCTCAGCATTGATTTC -3'
(R):5'- CACTCCGCAGGGCGTAAATGATAG -3'

Sequencing Primer
(F):5'- AGCATTGATTTCTTACCTGCCG -3'
(R):5'- GGCGTAAATGATAGGATTGACC -3'
Posted On2013-11-08