Incidental Mutation 'R0945:Myrfl'
ID82069
Institutional Source Beutler Lab
Gene Symbol Myrfl
Ensembl Gene ENSMUSG00000034057
Gene Namemyelin regulatory factor-like
SynonymsLOC237558, Gm239
MMRRC Submission 039084-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0945 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location116776535-116896919 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 116803394 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048229]
Predicted Effect probably benign
Transcript: ENSMUST00000048229
SMART Domains Protein: ENSMUSP00000037477
Gene: ENSMUSG00000034057

DomainStartEndE-ValueType
Pfam:NDT80_PhoG 252 399 3.4e-29 PFAM
Pfam:Peptidase_S74 446 505 1.6e-18 PFAM
Pfam:MRF_C1 525 560 1.8e-24 PFAM
low complexity region 562 601 N/A INTRINSIC
transmembrane domain 625 647 N/A INTRINSIC
low complexity region 663 691 N/A INTRINSIC
Pfam:MRF_C2 765 903 4e-53 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.1%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 A G 16: 35,290,111 M883V probably benign Het
Allc A G 12: 28,559,963 S212P probably benign Het
Anxa10 A G 8: 62,060,245 probably benign Het
Apoa2 A G 1: 171,225,699 probably null Het
Arfgef2 T C 2: 166,826,969 probably benign Het
Arhgap30 G T 1: 171,403,286 V204L probably damaging Het
Cd109 T A 9: 78,688,941 V852E possibly damaging Het
Ceacam5 T A 7: 17,747,344 Y339N probably damaging Het
Chaf1a A G 17: 56,067,441 D876G probably damaging Het
Chd9 A G 8: 90,933,002 K197E possibly damaging Het
Cnr2 A T 4: 135,917,321 M237L probably benign Het
Dnm2 C A 9: 21,505,660 Q830K probably damaging Het
Dst T C 1: 34,271,419 L1615P probably damaging Het
Eid1 A G 2: 125,673,577 D129G probably damaging Het
Exoc5 A G 14: 49,039,342 probably benign Het
Greb1 T C 12: 16,673,802 Y1854C probably benign Het
Il15ra T A 2: 11,718,327 V54E probably damaging Het
Il4i1 G A 7: 44,839,704 V306M probably damaging Het
Lrsam1 T C 2: 32,947,909 D211G probably benign Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Nell1 A G 7: 50,219,585 I203V probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr112 G A 17: 37,563,387 T308I probably benign Het
Olfr1234 T C 2: 89,363,255 Y58C probably damaging Het
Olfr654 T A 7: 104,588,672 N289K probably damaging Het
Pdxdc1 A G 16: 13,857,432 L345P probably damaging Het
Pex3 C A 10: 13,542,676 A79S probably benign Het
Pla2r1 A C 2: 60,458,410 L626R possibly damaging Het
Plcb3 A G 19: 6,954,878 S1107P probably damaging Het
Ppcdc C T 9: 57,420,158 probably null Het
Rbak A T 5: 143,173,579 F573Y probably damaging Het
Rfc1 A G 5: 65,278,709 probably null Het
Rpl13 C T 8: 123,105,174 A203V possibly damaging Het
Scn8a A G 15: 101,015,787 H1020R possibly damaging Het
Slf1 A G 13: 77,103,471 probably benign Het
Synj1 A G 16: 90,960,445 L905S possibly damaging Het
Tmem59 T A 4: 107,187,725 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uri1 A T 7: 37,969,678 D127E probably damaging Het
Usp31 T C 7: 121,670,253 E489G probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp941 C T 7: 140,811,664 R594H probably damaging Het
Zfy1 T C Y: 725,983 D594G probably damaging Het
Other mutations in Myrfl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Myrfl APN 10 116796106 missense possibly damaging 0.46
IGL00824:Myrfl APN 10 116849359 splice site probably benign
IGL01074:Myrfl APN 10 116779585 missense possibly damaging 0.50
IGL01394:Myrfl APN 10 116822687 missense probably benign 0.01
IGL02283:Myrfl APN 10 116777360 missense probably benign 0.33
IGL02869:Myrfl APN 10 116829004 missense probably damaging 0.98
IGL02878:Myrfl APN 10 116777405 missense possibly damaging 0.70
IGL03112:Myrfl APN 10 116803406 missense probably benign 0.03
F5770:Myrfl UTSW 10 116861530 missense probably damaging 1.00
R0138:Myrfl UTSW 10 116849233 missense probably damaging 0.98
R0402:Myrfl UTSW 10 116828977 missense probably damaging 1.00
R0554:Myrfl UTSW 10 116828973 missense probably damaging 1.00
R0601:Myrfl UTSW 10 116776760 missense probably damaging 1.00
R0790:Myrfl UTSW 10 116817788 missense probably damaging 0.99
R0831:Myrfl UTSW 10 116783209 missense probably benign 0.06
R0931:Myrfl UTSW 10 116839449 missense probably benign 0.01
R1078:Myrfl UTSW 10 116776732 missense possibly damaging 0.94
R1187:Myrfl UTSW 10 116831542 missense probably damaging 1.00
R1329:Myrfl UTSW 10 116777342 critical splice donor site probably null
R1432:Myrfl UTSW 10 116777427 missense probably damaging 1.00
R1762:Myrfl UTSW 10 116798593 missense probably damaging 1.00
R1827:Myrfl UTSW 10 116832947 missense probably damaging 0.99
R1952:Myrfl UTSW 10 116822811 missense probably benign 0.00
R2138:Myrfl UTSW 10 116795538 missense probably benign 0.00
R2317:Myrfl UTSW 10 116839384 missense possibly damaging 0.77
R2930:Myrfl UTSW 10 116817747 missense probably damaging 1.00
R3405:Myrfl UTSW 10 116822865 missense probably damaging 1.00
R4118:Myrfl UTSW 10 116828965 missense probably damaging 1.00
R4700:Myrfl UTSW 10 116777342 critical splice donor site probably null
R5039:Myrfl UTSW 10 116822711 missense probably damaging 1.00
R5097:Myrfl UTSW 10 116817704 missense probably damaging 1.00
R5138:Myrfl UTSW 10 116796058 critical splice donor site probably null
R5211:Myrfl UTSW 10 116798630 missense probably benign 0.00
R5249:Myrfl UTSW 10 116783233 missense probably benign
R5573:Myrfl UTSW 10 116822756 missense probably damaging 0.98
R6033:Myrfl UTSW 10 116849101 missense probably benign
R6033:Myrfl UTSW 10 116849101 missense probably benign
R6091:Myrfl UTSW 10 116849206 missense probably benign
R6315:Myrfl UTSW 10 116822819 missense possibly damaging 0.81
R6812:Myrfl UTSW 10 116832913 missense probably damaging 1.00
R6867:Myrfl UTSW 10 116848282 nonsense probably null
R7019:Myrfl UTSW 10 116781947 critical splice donor site probably null
R7059:Myrfl UTSW 10 116849206 missense probably benign
R7181:Myrfl UTSW 10 116861543 missense probably damaging 0.96
R7471:Myrfl UTSW 10 116861512 missense possibly damaging 0.95
V7582:Myrfl UTSW 10 116861530 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCTGTCAAACTCAGCAGTAGG -3'
(R):5'- CATTGTGTTCCCTTCCAGGACCAG -3'

Sequencing Primer
(F):5'- GAGCCCAGGAAATGGCTTTTAATTC -3'
(R):5'- CCTTCCAGGACCAGATCTTC -3'
Posted On2013-11-08