Incidental Mutation 'R0945:Adcy5'
ID82077
Institutional Source Beutler Lab
Gene Symbol Adcy5
Ensembl Gene ENSMUSG00000022840
Gene Nameadenylate cyclase 5
SynonymsAC5
MMRRC Submission 039084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R0945 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location35154877-35305738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35290111 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 883 (M883V)
Ref Sequence ENSEMBL: ENSMUSP00000110563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114913]
Predicted Effect probably benign
Transcript: ENSMUST00000114913
AA Change: M883V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840
AA Change: M883V

DomainStartEndE-ValueType
low complexity region 47 59 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 107 150 N/A INTRINSIC
low complexity region 158 175 N/A INTRINSIC
low complexity region 181 208 N/A INTRINSIC
low complexity region 243 258 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
CYCc 424 623 2.62e-69 SMART
Pfam:DUF1053 669 762 1.8e-30 PFAM
transmembrane domain 794 816 N/A INTRINSIC
transmembrane domain 837 856 N/A INTRINSIC
transmembrane domain 910 932 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 985 1004 N/A INTRINSIC
CYCc 1032 1240 2.98e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231960
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.1%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Allc A G 12: 28,559,963 S212P probably benign Het
Anxa10 A G 8: 62,060,245 probably benign Het
Apoa2 A G 1: 171,225,699 probably null Het
Arfgef2 T C 2: 166,826,969 probably benign Het
Arhgap30 G T 1: 171,403,286 V204L probably damaging Het
Cd109 T A 9: 78,688,941 V852E possibly damaging Het
Ceacam5 T A 7: 17,747,344 Y339N probably damaging Het
Chaf1a A G 17: 56,067,441 D876G probably damaging Het
Chd9 A G 8: 90,933,002 K197E possibly damaging Het
Cnr2 A T 4: 135,917,321 M237L probably benign Het
Dnm2 C A 9: 21,505,660 Q830K probably damaging Het
Dst T C 1: 34,271,419 L1615P probably damaging Het
Eid1 A G 2: 125,673,577 D129G probably damaging Het
Exoc5 A G 14: 49,039,342 probably benign Het
Greb1 T C 12: 16,673,802 Y1854C probably benign Het
Il15ra T A 2: 11,718,327 V54E probably damaging Het
Il4i1 G A 7: 44,839,704 V306M probably damaging Het
Lrsam1 T C 2: 32,947,909 D211G probably benign Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Myrfl C T 10: 116,803,394 probably benign Het
Nell1 A G 7: 50,219,585 I203V probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr112 G A 17: 37,563,387 T308I probably benign Het
Olfr1234 T C 2: 89,363,255 Y58C probably damaging Het
Olfr654 T A 7: 104,588,672 N289K probably damaging Het
Pdxdc1 A G 16: 13,857,432 L345P probably damaging Het
Pex3 C A 10: 13,542,676 A79S probably benign Het
Pla2r1 A C 2: 60,458,410 L626R possibly damaging Het
Plcb3 A G 19: 6,954,878 S1107P probably damaging Het
Ppcdc C T 9: 57,420,158 probably null Het
Rbak A T 5: 143,173,579 F573Y probably damaging Het
Rfc1 A G 5: 65,278,709 probably null Het
Rpl13 C T 8: 123,105,174 A203V possibly damaging Het
Scn8a A G 15: 101,015,787 H1020R possibly damaging Het
Slf1 A G 13: 77,103,471 probably benign Het
Synj1 A G 16: 90,960,445 L905S possibly damaging Het
Tmem59 T A 4: 107,187,725 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uri1 A T 7: 37,969,678 D127E probably damaging Het
Usp31 T C 7: 121,670,253 E489G probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp941 C T 7: 140,811,664 R594H probably damaging Het
Zfy1 T C Y: 725,983 D594G probably damaging Het
Other mutations in Adcy5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Adcy5 APN 16 35253213 missense possibly damaging 0.49
IGL01583:Adcy5 APN 16 35283513 splice site probably benign
IGL01608:Adcy5 APN 16 35272165 missense probably damaging 1.00
IGL02097:Adcy5 APN 16 35272098 missense probably damaging 1.00
IGL02122:Adcy5 APN 16 35283612 splice site probably benign
IGL02532:Adcy5 APN 16 35272083 missense possibly damaging 0.79
IGL02814:Adcy5 APN 16 35303649 missense probably benign 0.08
IGL02877:Adcy5 APN 16 35298600 missense probably damaging 1.00
IGL03026:Adcy5 APN 16 35157042 missense probably benign 0.41
IGL03345:Adcy5 APN 16 35248814 missense probably benign 0.05
H8562:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
H8786:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
R0050:Adcy5 UTSW 16 35304303 utr 3 prime probably benign
R0091:Adcy5 UTSW 16 35270998 critical splice donor site probably null
R0112:Adcy5 UTSW 16 35156178 missense possibly damaging 0.85
R0398:Adcy5 UTSW 16 35269068 missense probably damaging 1.00
R0457:Adcy5 UTSW 16 35274545 missense probably benign 0.07
R0554:Adcy5 UTSW 16 35294017 missense probably benign 0.26
R0698:Adcy5 UTSW 16 35290082 missense possibly damaging 0.78
R0761:Adcy5 UTSW 16 35270825 splice site probably benign
R0865:Adcy5 UTSW 16 35274471 missense probably damaging 0.96
R0927:Adcy5 UTSW 16 35156243 missense probably benign 0.32
R1534:Adcy5 UTSW 16 35253259 missense possibly damaging 0.92
R1565:Adcy5 UTSW 16 35268957 missense probably damaging 1.00
R1721:Adcy5 UTSW 16 35298424 missense probably damaging 1.00
R1839:Adcy5 UTSW 16 35248940 missense probably damaging 1.00
R2047:Adcy5 UTSW 16 35290108 missense possibly damaging 0.78
R3052:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3053:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3827:Adcy5 UTSW 16 35290097 missense probably benign 0.03
R4398:Adcy5 UTSW 16 35268993 missense probably damaging 1.00
R4700:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R4965:Adcy5 UTSW 16 35278502 missense possibly damaging 0.82
R5229:Adcy5 UTSW 16 35269070 missense probably damaging 0.99
R5456:Adcy5 UTSW 16 35298522 missense probably damaging 1.00
R5586:Adcy5 UTSW 16 35157116 missense probably damaging 0.99
R5757:Adcy5 UTSW 16 35272081 missense probably damaging 1.00
R5959:Adcy5 UTSW 16 35298410 missense probably damaging 1.00
R6011:Adcy5 UTSW 16 35157228 missense probably benign 0.05
R6277:Adcy5 UTSW 16 35289526 missense probably benign 0.02
R6296:Adcy5 UTSW 16 35303710 missense probably damaging 1.00
R6379:Adcy5 UTSW 16 35293999 missense probably benign 0.13
R6431:Adcy5 UTSW 16 35279237 missense probably damaging 1.00
R6685:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R6728:Adcy5 UTSW 16 35157165 missense possibly damaging 0.88
R6755:Adcy5 UTSW 16 35303634 missense possibly damaging 0.95
R6887:Adcy5 UTSW 16 35298590 missense possibly damaging 0.74
R7029:Adcy5 UTSW 16 35299648 missense probably null 0.91
R7047:Adcy5 UTSW 16 35267215 missense probably damaging 1.00
R7050:Adcy5 UTSW 16 35303700 missense possibly damaging 0.88
R7102:Adcy5 UTSW 16 35299625 missense probably damaging 1.00
R7150:Adcy5 UTSW 16 35298534 missense probably damaging 1.00
R7242:Adcy5 UTSW 16 35156835 missense probably damaging 1.00
R7387:Adcy5 UTSW 16 35272090 missense probably damaging 1.00
V7732:Adcy5 UTSW 16 35283541 missense probably benign 0.00
X0022:Adcy5 UTSW 16 35299456 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGCCTTTAGAAGGTGCCATCCC -3'
(R):5'- CCCAGCTATGTTGTGAACACCGTC -3'

Sequencing Primer
(F):5'- AAGGTGCCATCCCTGTAGC -3'
(R):5'- ACACCGTCTTTGTAATAAGGAGG -3'
Posted On2013-11-08