Incidental Mutation 'R0862:Trim43c'
ID82157
Institutional Source Beutler Lab
Gene Symbol Trim43c
Ensembl Gene ENSMUSG00000067399
Gene Nametripartite motif-containing 43C
SynonymsTrim43
MMRRC Submission 039036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R0862 (G1)
Quality Score171
Status Validated
Chromosome9
Chromosomal Location88839164-88848190 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88843034 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 202 (H202L)
Ref Sequence ENSEMBL: ENSMUSP00000139715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163255] [ENSMUST00000186363]
Predicted Effect probably benign
Transcript: ENSMUST00000163255
AA Change: H203L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129255
Gene: ENSMUSG00000067399
AA Change: H203L

DomainStartEndE-ValueType
RING 16 56 3.34e-6 SMART
PDB:2IWG|E 329 446 3e-15 PDB
Blast:SPRY 336 441 3e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180783
Predicted Effect probably benign
Transcript: ENSMUST00000186363
AA Change: H202L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000139715
Gene: ENSMUSG00000067399
AA Change: H202L

DomainStartEndE-ValueType
RING 16 56 1.6e-8 SMART
SPRY 334 445 6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188156
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 94.9%
  • 20x: 87.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
9230009I02Rik T C 11: 51,091,317 noncoding transcript Het
Adamts13 G A 2: 27,006,324 probably null Het
Chac1 C A 2: 119,353,469 A184E probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Csmd1 T A 8: 16,190,026 Y1124F probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Dyrk4 T C 6: 126,877,333 E499G possibly damaging Het
Fat1 T A 8: 45,018,037 I1603N probably damaging Het
Fbn1 A T 2: 125,342,891 C1660* probably null Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gm19684 A T 17: 36,121,900 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Map4 A G 9: 109,978,969 Y34C probably damaging Het
Mapk8 C T 14: 33,392,992 R189H probably damaging Het
Mgst1 C T 6: 138,147,751 T21M probably damaging Het
Msh2 A G 17: 87,680,052 T207A probably benign Het
Mthfd2 A G 6: 83,313,394 V85A probably damaging Het
Muc4 A G 16: 32,752,002 S627G probably benign Het
Nbeal2 G A 9: 110,628,195 T2266I probably damaging Het
Olfr26 T C 9: 38,855,182 V40A possibly damaging Het
Olfr623 T C 7: 103,660,528 T241A probably damaging Het
Olfr828 T C 9: 18,815,706 Y196C probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd6ip A T 9: 113,674,510 probably benign Het
Piwil2 T C 14: 70,395,374 D583G probably benign Het
Plin4 T A 17: 56,103,966 M1022L probably benign Het
Rbm48 A G 5: 3,590,438 S314P probably benign Het
Rbms3 A T 9: 117,629,792 probably benign Het
Snx14 A T 9: 88,383,996 S726T possibly damaging Het
Trip12 A G 1: 84,744,009 F1334S probably damaging Het
Tyk2 T C 9: 21,116,167 H503R probably benign Het
Ubr2 G A 17: 46,967,083 Q745* probably null Het
Ush2a T A 1: 188,542,818 Y1829* probably null Het
Vmn2r65 T A 7: 84,943,645 E451D probably benign Het
Other mutations in Trim43c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Trim43c APN 9 88841856 missense probably benign 0.20
IGL02414:Trim43c APN 9 88841832 critical splice acceptor site probably null
R0054:Trim43c UTSW 9 88847515 missense probably damaging 1.00
R0765:Trim43c UTSW 9 88841916 missense probably benign 0.28
R0864:Trim43c UTSW 9 88843034 missense probably benign 0.01
R1117:Trim43c UTSW 9 88844977 missense probably benign 0.20
R1222:Trim43c UTSW 9 88843078 missense possibly damaging 0.70
R1643:Trim43c UTSW 9 88847477 missense probably damaging 0.97
R1691:Trim43c UTSW 9 88840699 missense probably damaging 0.98
R1914:Trim43c UTSW 9 88840617 missense probably benign 0.01
R3718:Trim43c UTSW 9 88844977 missense probably benign 0.20
R3772:Trim43c UTSW 9 88847757 missense probably damaging 1.00
R3852:Trim43c UTSW 9 88840401 missense probably damaging 1.00
R4774:Trim43c UTSW 9 88847652 missense possibly damaging 0.48
R5784:Trim43c UTSW 9 88847643 missense probably benign 0.03
R5833:Trim43c UTSW 9 88843037 missense possibly damaging 0.74
R6177:Trim43c UTSW 9 88840547 missense possibly damaging 0.50
R6407:Trim43c UTSW 9 88840414 missense probably benign
R6490:Trim43c UTSW 9 88844950 missense possibly damaging 0.50
R6892:Trim43c UTSW 9 88844924 missense probably benign 0.35
Z1088:Trim43c UTSW 9 88842935 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCAGTGTGTGCAGCACTCTGATG -3'
(R):5'- AAAAGCCACAGGTGTGGTCCTC -3'

Sequencing Primer
(F):5'- AGCACTCTGATGGGCTCC -3'
(R):5'- GTGGTCCTCAGATAATGAAGCTC -3'
Posted On2013-11-08