Incidental Mutation 'R0863:Tbc1d7'
ID82214
Institutional Source Beutler Lab
Gene Symbol Tbc1d7
Ensembl Gene ENSMUSG00000021368
Gene NameTBC1 domain family, member 7
Synonyms
MMRRC Submission 039037-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.714) question?
Stock #R0863 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location43151740-43171501 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 43154685 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021797] [ENSMUST00000179852] [ENSMUST00000220787] [ENSMUST00000221352] [ENSMUST00000221795] [ENSMUST00000222160] [ENSMUST00000223000]
Predicted Effect probably benign
Transcript: ENSMUST00000021797
SMART Domains Protein: ENSMUSP00000021797
Gene: ENSMUSG00000021368

DomainStartEndE-ValueType
SCOP:d1fkma1 24 90 5e-3 SMART
Pfam:RabGAP-TBC 133 251 2.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179852
SMART Domains Protein: ENSMUSP00000137280
Gene: ENSMUSG00000021368

DomainStartEndE-ValueType
SCOP:d1fkma1 24 90 5e-3 SMART
Pfam:RabGAP-TBC 133 251 5.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220579
Predicted Effect probably benign
Transcript: ENSMUST00000220787
Predicted Effect probably benign
Transcript: ENSMUST00000221352
Predicted Effect probably benign
Transcript: ENSMUST00000221795
Predicted Effect probably benign
Transcript: ENSMUST00000222160
Predicted Effect probably benign
Transcript: ENSMUST00000223000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223076
Meta Mutation Damage Score 0.1076 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 94% (59/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TBC-domain containing protein family. The encoded protein functions as a subunit of the tuberous sclerosis TSC1-TSC2 complex which plays a role in the regulation of cellular growth and differentiation. Mutations in this gene have been associated with autosomal recessive megalencephaly. Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between this locus and downstream LOC100130357. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
2310016G11Rik A G 7: 44,677,808 noncoding transcript Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca14 A T 7: 120,216,230 T234S probably benign Het
Acap1 C A 11: 69,887,056 V119L probably damaging Het
Actr2 C T 11: 20,080,760 V163I probably benign Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Arnt2 T A 7: 84,265,584 K524M probably damaging Het
Brca1 T C 11: 101,524,770 Y846C probably benign Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Cep350 T A 1: 155,862,235 I2621L probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fank1 A G 7: 133,880,623 R73G possibly damaging Het
Fes A T 7: 80,380,886 W552R probably damaging Het
Fsd2 A G 7: 81,542,165 V488A possibly damaging Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gm9493 A T 19: 23,619,809 Q23L probably benign Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lonp1 T C 17: 56,618,331 K487R probably damaging Het
Ltbp1 A G 17: 75,252,386 Y290C probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Ms4a10 C T 19: 10,968,593 G58D probably damaging Het
Muc5b A G 7: 141,867,717 S4315G probably benign Het
Nlrp1b T A 11: 71,181,347 T557S probably benign Het
Nlrp3 A G 11: 59,565,850 D946G probably benign Het
Obscn T C 11: 58,995,415 probably benign Het
Olfr469 T C 7: 107,823,374 S32G probably benign Het
Olfr509 A G 7: 108,645,658 I306T probably benign Het
Olfr866 A T 9: 20,027,213 S242T probably damaging Het
Pask A T 1: 93,314,339 F1219I probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Plec G A 15: 76,174,080 Q3751* probably null Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sema4a C T 3: 88,448,149 probably benign Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Spag1 G T 15: 36,192,047 K217N probably damaging Het
Ssh1 C T 5: 113,966,731 R9H probably damaging Het
St3gal4 C A 9: 35,053,448 V155F probably damaging Het
Stxbp5 C T 10: 9,809,040 E539K possibly damaging Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Ttc21b T C 2: 66,242,773 I190V probably benign Het
Ttn T C 2: 76,707,047 T34846A probably benign Het
Ube4a A G 9: 44,949,816 V232A possibly damaging Het
Uri1 A T 7: 37,969,675 D122E probably damaging Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zan T A 5: 137,458,639 E1278D unknown Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Tbc1d7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Tbc1d7 APN 13 43159321 missense probably damaging 1.00
IGL01460:Tbc1d7 APN 13 43165359 missense probably benign 0.00
IGL02653:Tbc1d7 APN 13 43165398 missense probably benign
IGL03046:Tbc1d7 APN 13 43154686 splice site probably null
R0165:Tbc1d7 UTSW 13 43153202 splice site probably null
R0427:Tbc1d7 UTSW 13 43153087 missense probably benign 0.01
R0930:Tbc1d7 UTSW 13 43165336 nonsense probably null
R1181:Tbc1d7 UTSW 13 43153139 missense probably damaging 1.00
R1792:Tbc1d7 UTSW 13 43165377 missense probably benign
R2113:Tbc1d7 UTSW 13 43153086 missense probably damaging 0.99
R4354:Tbc1d7 UTSW 13 43169868 missense probably damaging 1.00
R4743:Tbc1d7 UTSW 13 43169849 missense probably damaging 1.00
R5407:Tbc1d7 UTSW 13 43154702 missense probably benign 0.01
R6049:Tbc1d7 UTSW 13 43159360 missense probably damaging 0.99
R6320:Tbc1d7 UTSW 13 43152933 unclassified probably benign
R7024:Tbc1d7 UTSW 13 43154735 missense probably damaging 1.00
R7241:Tbc1d7 UTSW 13 43153017 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGGAGACCCAGGCTACAGTTACAG -3'
(R):5'- TTGAGCACAGAGAGTCCTGCAACC -3'

Sequencing Primer
(F):5'- GGCTACAGTTACAGAAACTGC -3'
(R):5'- AGGACTGACTTGATGCTTCTCAC -3'
Posted On2013-11-08