Incidental Mutation 'R0863:Ms4a10'
ID82232
Institutional Source Beutler Lab
Gene Symbol Ms4a10
Ensembl Gene ENSMUSG00000024731
Gene Namemembrane-spanning 4-domains, subfamily A, member 10
Synonyms2010001N17Rik
MMRRC Submission 039037-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.042) question?
Stock #R0863 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10962293-10974670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10968593 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 58 (G58D)
Ref Sequence ENSEMBL: ENSMUSP00000140111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072748] [ENSMUST00000190246] [ENSMUST00000191343]
Predicted Effect probably damaging
Transcript: ENSMUST00000072748
AA Change: G58D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072531
Gene: ENSMUSG00000024731
AA Change: G58D

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Pfam:CD20 56 190 6e-10 PFAM
low complexity region 239 252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190246
SMART Domains Protein: ENSMUSP00000140826
Gene: ENSMUSG00000024731

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191343
AA Change: G58D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140111
Gene: ENSMUSG00000024731
AA Change: G58D

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Pfam:CD20 57 150 7.9e-14 PFAM
low complexity region 199 212 N/A INTRINSIC
Meta Mutation Damage Score 0.0368 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 94% (59/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Most MS4A genes, including MS4A10, encode proteins with at least 4 potential transmembrane domains and N- and C-terminal cytoplasmic domains encoded by distinct exons.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
2310016G11Rik A G 7: 44,677,808 noncoding transcript Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca14 A T 7: 120,216,230 T234S probably benign Het
Acap1 C A 11: 69,887,056 V119L probably damaging Het
Actr2 C T 11: 20,080,760 V163I probably benign Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Arnt2 T A 7: 84,265,584 K524M probably damaging Het
Brca1 T C 11: 101,524,770 Y846C probably benign Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Cep350 T A 1: 155,862,235 I2621L probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fank1 A G 7: 133,880,623 R73G possibly damaging Het
Fes A T 7: 80,380,886 W552R probably damaging Het
Fsd2 A G 7: 81,542,165 V488A possibly damaging Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gm9493 A T 19: 23,619,809 Q23L probably benign Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lonp1 T C 17: 56,618,331 K487R probably damaging Het
Ltbp1 A G 17: 75,252,386 Y290C probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Muc5b A G 7: 141,867,717 S4315G probably benign Het
Nlrp1b T A 11: 71,181,347 T557S probably benign Het
Nlrp3 A G 11: 59,565,850 D946G probably benign Het
Obscn T C 11: 58,995,415 probably benign Het
Olfr469 T C 7: 107,823,374 S32G probably benign Het
Olfr509 A G 7: 108,645,658 I306T probably benign Het
Olfr866 A T 9: 20,027,213 S242T probably damaging Het
Pask A T 1: 93,314,339 F1219I probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Plec G A 15: 76,174,080 Q3751* probably null Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sema4a C T 3: 88,448,149 probably benign Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Spag1 G T 15: 36,192,047 K217N probably damaging Het
Ssh1 C T 5: 113,966,731 R9H probably damaging Het
St3gal4 C A 9: 35,053,448 V155F probably damaging Het
Stxbp5 C T 10: 9,809,040 E539K possibly damaging Het
Tbc1d7 G T 13: 43,154,685 probably benign Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Ttc21b T C 2: 66,242,773 I190V probably benign Het
Ttn T C 2: 76,707,047 T34846A probably benign Het
Ube4a A G 9: 44,949,816 V232A possibly damaging Het
Uri1 A T 7: 37,969,675 D122E probably damaging Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zan T A 5: 137,458,639 E1278D unknown Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Ms4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Ms4a10 APN 19 10963010 missense probably benign
IGL03031:Ms4a10 APN 19 10968671 missense probably benign 0.01
P0027:Ms4a10 UTSW 19 10964128 missense probably damaging 0.99
R1456:Ms4a10 UTSW 19 10964733 missense possibly damaging 0.91
R1509:Ms4a10 UTSW 19 10964108 missense probably benign 0.01
R1838:Ms4a10 UTSW 19 10964047 missense possibly damaging 0.92
R4583:Ms4a10 UTSW 19 10968189 missense possibly damaging 0.94
R4932:Ms4a10 UTSW 19 10964768 missense probably damaging 1.00
R5548:Ms4a10 UTSW 19 10968120 critical splice donor site probably null
R5819:Ms4a10 UTSW 19 10968690 missense probably benign 0.00
R5952:Ms4a10 UTSW 19 10964122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACTAGCAGTGCCTGGACCTAC -3'
(R):5'- TCTGATCCTTGGACACAAGCTCAAC -3'

Sequencing Primer
(F):5'- GGATGTCAAAACCCCACTTGG -3'
(R):5'- TTGGACACAAGCTCAACTTTAAC -3'
Posted On2013-11-08