Incidental Mutation 'R0863:Mgea5'
ID82234
Institutional Source Beutler Lab
Gene Symbol Mgea5
Ensembl Gene ENSMUSG00000025220
Gene Namemeningioma expressed antigen 5 (hyaluronidase)
Synonyms2810009A20Rik, Hy5, 5830447M11Rik, 4833427O07Rik
MMRRC Submission 039037-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0863 (G1)
Quality Score120
Status Validated
Chromosome19
Chromosomal Location45750261-45783520 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45782986 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 49 (A49T)
Ref Sequence ENSEMBL: ENSMUSP00000026243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026243]
Predicted Effect probably benign
Transcript: ENSMUST00000026243
AA Change: A49T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026243
Gene: ENSMUSG00000025220
AA Change: A49T

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:NAGidase 62 361 2.5e-84 PFAM
low complexity region 453 458 N/A INTRINSIC
PDB:4BMH|A 700 915 1e-13 PDB
SCOP:d1cjwa_ 715 916 1e-3 SMART
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 94% (59/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The dynamic modification of cytoplasmic and nuclear proteins by O-linked N-acetylglucosamine (O-GlcNAc) addition and removal on serine and threonine residues is catalyzed by OGT (MIM 300255), which adds O-GlcNAc, and MGEA5, a glycosidase that removes O-GlcNAc modifications (Gao et al., 2001 [PubMed 11148210]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit perinatal lethality associated with a developmental delay and respiratory failure. Mouse embryonic fibroblasts exhibit proliferative and mitotic defects, frequent cytokinesis failure, and loss of genomic stability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
2310016G11Rik A G 7: 44,677,808 noncoding transcript Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca14 A T 7: 120,216,230 T234S probably benign Het
Acap1 C A 11: 69,887,056 V119L probably damaging Het
Actr2 C T 11: 20,080,760 V163I probably benign Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Arnt2 T A 7: 84,265,584 K524M probably damaging Het
Brca1 T C 11: 101,524,770 Y846C probably benign Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Cep350 T A 1: 155,862,235 I2621L probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fank1 A G 7: 133,880,623 R73G possibly damaging Het
Fes A T 7: 80,380,886 W552R probably damaging Het
Fsd2 A G 7: 81,542,165 V488A possibly damaging Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gm9493 A T 19: 23,619,809 Q23L probably benign Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lonp1 T C 17: 56,618,331 K487R probably damaging Het
Ltbp1 A G 17: 75,252,386 Y290C probably damaging Het
Ms4a10 C T 19: 10,968,593 G58D probably damaging Het
Muc5b A G 7: 141,867,717 S4315G probably benign Het
Nlrp1b T A 11: 71,181,347 T557S probably benign Het
Nlrp3 A G 11: 59,565,850 D946G probably benign Het
Obscn T C 11: 58,995,415 probably benign Het
Olfr469 T C 7: 107,823,374 S32G probably benign Het
Olfr509 A G 7: 108,645,658 I306T probably benign Het
Olfr866 A T 9: 20,027,213 S242T probably damaging Het
Pask A T 1: 93,314,339 F1219I probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Plec G A 15: 76,174,080 Q3751* probably null Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sema4a C T 3: 88,448,149 probably benign Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Spag1 G T 15: 36,192,047 K217N probably damaging Het
Ssh1 C T 5: 113,966,731 R9H probably damaging Het
St3gal4 C A 9: 35,053,448 V155F probably damaging Het
Stxbp5 C T 10: 9,809,040 E539K possibly damaging Het
Tbc1d7 G T 13: 43,154,685 probably benign Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Ttc21b T C 2: 66,242,773 I190V probably benign Het
Ttn T C 2: 76,707,047 T34846A probably benign Het
Ube4a A G 9: 44,949,816 V232A possibly damaging Het
Uri1 A T 7: 37,969,675 D122E probably damaging Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zan T A 5: 137,458,639 E1278D unknown Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Mgea5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Mgea5 APN 19 45765540 missense possibly damaging 0.89
IGL01845:Mgea5 APN 19 45767862 missense probably benign 0.00
IGL02039:Mgea5 APN 19 45773703 missense probably damaging 0.98
IGL02428:Mgea5 APN 19 45765501 missense probably damaging 1.00
IGL02581:Mgea5 APN 19 45752191 missense possibly damaging 0.53
IGL02971:Mgea5 APN 19 45762243 missense probably damaging 1.00
R0127:Mgea5 UTSW 19 45771888 missense probably damaging 1.00
R0815:Mgea5 UTSW 19 45782986 missense probably benign 0.00
R1127:Mgea5 UTSW 19 45752155 nonsense probably null
R1501:Mgea5 UTSW 19 45778640 missense probably null 1.00
R1514:Mgea5 UTSW 19 45776931 missense probably damaging 1.00
R1586:Mgea5 UTSW 19 45776910 missense possibly damaging 0.94
R1716:Mgea5 UTSW 19 45752174 missense probably benign 0.35
R1755:Mgea5 UTSW 19 45758406 missense possibly damaging 0.93
R1774:Mgea5 UTSW 19 45776984 missense probably benign 0.37
R2152:Mgea5 UTSW 19 45758022 nonsense probably null
R4403:Mgea5 UTSW 19 45778639 missense probably damaging 1.00
R4664:Mgea5 UTSW 19 45771945 missense probably benign 0.15
R4971:Mgea5 UTSW 19 45770046 splice site probably null
R5377:Mgea5 UTSW 19 45758022 nonsense probably null
R5571:Mgea5 UTSW 19 45777006 missense probably benign
R5639:Mgea5 UTSW 19 45776999 missense probably damaging 1.00
R5665:Mgea5 UTSW 19 45776997 missense probably benign 0.00
R5776:Mgea5 UTSW 19 45771924 missense probably damaging 1.00
R6050:Mgea5 UTSW 19 45765480 missense possibly damaging 0.95
R6054:Mgea5 UTSW 19 45776132 missense probably damaging 1.00
R6317:Mgea5 UTSW 19 45771680 critical splice donor site probably null
R6410:Mgea5 UTSW 19 45776045 splice site probably null
R6990:Mgea5 UTSW 19 45767476 missense probably benign 0.00
R7103:Mgea5 UTSW 19 45783166 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCAATGACGGACGCCTC -3'
(R):5'- GGCTTATCCCAAGGAAAGGCGG -3'

Sequencing Primer
(F):5'- TGGAAGGCCAACTCACCTT -3'
(R):5'- gagaggaagggggaaggg -3'
Posted On2013-11-08