Incidental Mutation 'R0865:Peak1'
ID82307
Institutional Source Beutler Lab
Gene Symbol Peak1
Ensembl Gene ENSMUSG00000074305
Gene Namepseudopodium-enriched atypical kinase 1
SynonymsC230081A13Rik, NKF3 kinase family member, 1110049L02Rik
MMRRC Submission 039039-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock #R0865 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location56201126-56418067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56257832 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 937 (D937E)
Ref Sequence ENSEMBL: ENSMUSP00000109901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061552] [ENSMUST00000186735]
Predicted Effect probably benign
Transcript: ENSMUST00000061552
AA Change: D937E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000109901
Gene: ENSMUSG00000074305
AA Change: D937E

DomainStartEndE-ValueType
low complexity region 247 259 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 498 509 N/A INTRINSIC
low complexity region 845 856 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 932 948 N/A INTRINSIC
Pfam:Pkinase_Tyr 1437 1649 1.5e-6 PFAM
Pfam:Pkinase 1440 1651 2.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181444
Predicted Effect probably benign
Transcript: ENSMUST00000186735
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-receptor tyrosine kinase that is a member of the new kinase family three (NFK3) family. In migrating cells, the encoded protein is associated with the actin cytoskeleton and focal adhesions and promotes developing focal adhesion elongation. This protein may play a role in the regulation of cell migration, proliferation and cancer metastasis. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 A G 15: 76,595,643 E581G probably damaging Het
Adcy5 A G 16: 35,274,471 N666S probably damaging Het
Apcs T C 1: 172,894,215 D188G probably benign Het
Arih2 A G 9: 108,649,300 probably benign Het
AU040320 A G 4: 126,848,884 K981E possibly damaging Het
Brwd1 A T 16: 96,068,584 I81K probably damaging Het
Cacng8 T A 7: 3,412,109 I136N possibly damaging Het
Ccdc114 A G 7: 45,942,088 T259A probably benign Het
Cdh22 A T 2: 165,181,056 W32R probably damaging Het
Cel A G 2: 28,560,615 S133P probably damaging Het
Clasp2 A G 9: 113,911,500 T495A possibly damaging Het
Clock A T 5: 76,266,424 probably benign Het
Cox6a2 A G 7: 128,205,823 probably benign Het
Cyp2b19 C A 7: 26,762,229 probably benign Het
Dnah11 G A 12: 118,190,844 Q234* probably null Het
Gga3 A T 11: 115,592,459 N91K probably damaging Het
Idh1 T C 1: 65,161,156 T350A probably benign Het
Ints11 A G 4: 155,887,107 probably null Het
Itgb1 A G 8: 128,710,251 probably null Het
Kank4 A T 4: 98,774,663 probably benign Het
Kansl1 A T 11: 104,424,368 D281E probably benign Het
Kmt2a T C 9: 44,818,770 probably benign Het
Kpna4 T C 3: 69,101,417 E145G probably damaging Het
Lacc1 A G 14: 77,034,144 I201T possibly damaging Het
Larp7 T C 3: 127,544,235 K392E probably damaging Het
Lbh T A 17: 72,921,229 M23K probably benign Het
Myo15 A T 11: 60,491,688 E361V probably damaging Het
Ncor2 A G 5: 125,038,982 S470P probably benign Het
Ngef T A 1: 87,484,601 M449L probably benign Het
Olfr18 T A 9: 20,314,749 Y57F probably damaging Het
Olfr322 T C 11: 58,665,652 I31T possibly damaging Het
Pnpla7 A G 2: 24,982,123 K72E probably benign Het
Ptprn T G 1: 75,248,138 probably null Het
Scgn C T 13: 23,962,119 probably null Het
Sdk2 T C 11: 113,850,922 I824V probably benign Het
Slc38a3 A G 9: 107,655,648 S326P probably damaging Het
Spen A G 4: 141,471,870 S3126P probably benign Het
Tbcd T C 11: 121,602,989 C902R possibly damaging Het
Tmem63b T C 17: 45,661,519 I721V probably benign Het
Trim30c A G 7: 104,390,451 S46P probably damaging Het
Trim59 T C 3: 69,037,608 D133G probably damaging Het
Trpm7 A T 2: 126,799,239 probably null Het
Ttll10 A G 4: 156,043,678 L391P probably damaging Het
Ttn T C 2: 76,793,241 T15331A possibly damaging Het
Vmn1r237 C T 17: 21,314,714 T233I probably damaging Het
Vmn2r115 A T 17: 23,346,408 D423V possibly damaging Het
Vmn2r25 T A 6: 123,853,017 R58S probably benign Het
Vmn2r71 A T 7: 85,619,308 I240F probably benign Het
Wdr3 A G 3: 100,152,796 probably benign Het
Zc3h14 T C 12: 98,779,269 probably null Het
Zc3hav1 C T 6: 38,353,902 probably benign Het
Zfp335 A T 2: 164,899,495 probably null Het
Other mutations in Peak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Peak1 APN 9 56227326 missense probably damaging 1.00
IGL00544:Peak1 APN 9 56259978 missense probably damaging 1.00
IGL01141:Peak1 APN 9 56258527 missense probably benign 0.01
IGL01743:Peak1 APN 9 56259202 missense probably damaging 1.00
IGL01781:Peak1 APN 9 56260065 missense possibly damaging 0.92
IGL01885:Peak1 APN 9 56260104 missense probably damaging 1.00
IGL01941:Peak1 APN 9 56258775 missense probably damaging 1.00
IGL02455:Peak1 APN 9 56227473 missense possibly damaging 0.89
IGL02719:Peak1 APN 9 56227206 missense probably damaging 1.00
IGL03247:Peak1 APN 9 56257930 missense probably damaging 1.00
IGL03259:Peak1 APN 9 56259967 missense probably damaging 1.00
R0060:Peak1 UTSW 9 56227823 missense probably damaging 1.00
R0087:Peak1 UTSW 9 56258325 missense probably damaging 1.00
R0480:Peak1 UTSW 9 56258632 missense probably benign 0.00
R0569:Peak1 UTSW 9 56260089 missense probably damaging 1.00
R0605:Peak1 UTSW 9 56227098 splice site probably benign
R1117:Peak1 UTSW 9 56258418 missense probably benign 0.05
R1922:Peak1 UTSW 9 56206687 missense probably damaging 1.00
R1959:Peak1 UTSW 9 56206789 missense probably damaging 1.00
R2069:Peak1 UTSW 9 56258759 missense probably damaging 1.00
R2083:Peak1 UTSW 9 56258949 missense probably damaging 1.00
R2154:Peak1 UTSW 9 56207212 missense probably damaging 1.00
R2407:Peak1 UTSW 9 56259226 missense probably damaging 1.00
R3832:Peak1 UTSW 9 56258383 missense probably benign
R3938:Peak1 UTSW 9 56260365 missense probably benign 0.01
R3964:Peak1 UTSW 9 56259979 missense probably damaging 1.00
R4192:Peak1 UTSW 9 56258741 missense probably damaging 1.00
R4381:Peak1 UTSW 9 56258427 missense probably benign 0.34
R4869:Peak1 UTSW 9 56227592 missense probably benign 0.06
R4994:Peak1 UTSW 9 56241276 missense possibly damaging 0.65
R5062:Peak1 UTSW 9 56260289 missense probably damaging 1.00
R5435:Peak1 UTSW 9 56206486 missense probably damaging 0.98
R5632:Peak1 UTSW 9 56257774 missense probably damaging 1.00
R5643:Peak1 UTSW 9 56258755 missense probably damaging 0.99
R5880:Peak1 UTSW 9 56207610 missense probably damaging 1.00
R5898:Peak1 UTSW 9 56207338 missense probably benign 0.19
R5986:Peak1 UTSW 9 56259442 missense probably benign 0.00
R6109:Peak1 UTSW 9 56259283 missense probably benign 0.01
R6284:Peak1 UTSW 9 56260296 missense probably benign 0.10
R6347:Peak1 UTSW 9 56258211 missense probably benign 0.00
R6374:Peak1 UTSW 9 56257666 missense probably damaging 1.00
R6471:Peak1 UTSW 9 56258259 missense probably damaging 1.00
R6717:Peak1 UTSW 9 56207239 missense probably benign 0.00
R7033:Peak1 UTSW 9 56259707 missense probably damaging 1.00
R7039:Peak1 UTSW 9 56257809 missense probably benign 0.01
R7100:Peak1 UTSW 9 56259393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCCGAGTTCCGCAGTAACACC -3'
(R):5'- TCCAAATTAGTGACGAGCGCCC -3'

Sequencing Primer
(F):5'- CGCAGTAACACCTCCTCTG -3'
(R):5'- TCCCCTTACCATGCAAGTAAC -3'
Posted On2013-11-08