Incidental Mutation 'R0866:Tlx3'
ID82357
Institutional Source Beutler Lab
Gene Symbol Tlx3
Ensembl Gene ENSMUSG00000040610
Gene NameT cell leukemia, homeobox 3
SynonymsHox11l2, Rnx, Tlx1l2
MMRRC Submission 039040-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0866 (G1)
Quality Score113
Status Validated
Chromosome11
Chromosomal Location33200752-33203589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 33203315 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 49 (G49W)
Ref Sequence ENSEMBL: ENSMUSP00000047457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037746]
Predicted Effect probably damaging
Transcript: ENSMUST00000037746
AA Change: G49W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047457
Gene: ENSMUSG00000040610
AA Change: G49W

DomainStartEndE-ValueType
low complexity region 45 53 N/A INTRINSIC
low complexity region 95 115 N/A INTRINSIC
HOX 166 228 1.37e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131851
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an orphan homeobox protein that encodes a DNA-binding nuclear transcription factor. A translocation [t(5;14)(q35;q32)] involving this gene is associated with T-cell acute lymphoblastic leukemia (T-ALL) in children and young adults. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice die within 1 day of birth due to a central respiratory failure that resembles human congenital central hypoventilation syndrome. Mice homozygous for an ENU-induced allele exhibit uncoordinated movements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik G T 6: 131,552,779 R112L unknown Het
Abcd4 G T 12: 84,611,733 A232E probably damaging Het
Acsm5 T A 7: 119,540,900 I508N probably damaging Het
Adam22 T C 5: 8,082,156 Q263R probably damaging Het
Ccdc88c A G 12: 100,913,192 L1890P probably benign Het
Ckap4 C T 10: 84,527,520 D560N probably damaging Het
Crb3 T A 17: 57,062,743 L17Q probably damaging Het
Fbxo21 G T 5: 117,977,033 R78L probably benign Het
Gapvd1 A T 2: 34,709,217 C669S probably damaging Het
Gria2 A T 3: 80,722,024 probably benign Het
H2-M11 T C 17: 36,548,937 L274P probably benign Het
Hmox1 A G 8: 75,097,303 T200A probably benign Het
Hspa8 G A 9: 40,802,624 probably null Het
Isy1 C A 6: 87,819,112 R281L probably benign Het
Kiz C A 2: 146,856,053 probably benign Het
Lrig2 T C 3: 104,464,275 K704R probably benign Het
Lrp1 A T 10: 127,539,278 D4484E probably damaging Het
Lrrc7 C A 3: 158,164,266 probably benign Het
Mtmr14 T C 6: 113,239,582 probably null Het
Mtmr3 A T 11: 4,488,474 V660E probably benign Het
Mtor T C 4: 148,486,056 I1190T probably benign Het
Mtrf1l T C 10: 5,813,376 R318G probably damaging Het
Myh7 T C 14: 54,973,139 T1739A probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr186 C T 16: 59,027,428 V160I probably benign Het
Pcca A G 14: 122,889,545 E722G possibly damaging Het
Pds5b T A 5: 150,739,191 probably benign Het
Ralgapa2 A T 2: 146,436,003 F413I probably damaging Het
Rbbp9 T C 2: 144,550,708 Y24C probably damaging Het
Rgs2 A G 1: 144,002,250 S103P probably damaging Het
Rtn1 G T 12: 72,308,382 Y263* probably null Het
Slc22a1 T C 17: 12,657,046 E427G probably benign Het
Speg A G 1: 75,417,083 T1695A probably damaging Het
Tor1b A G 2: 30,956,916 M292V probably benign Het
Tspyl3 A T 2: 153,224,934 L128Q probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfc3h1 G A 10: 115,427,716 V1821I probably benign Het
Zfhx4 A T 3: 5,412,212 T3271S possibly damaging Het
Zfp386 G T 12: 116,054,709 probably benign Het
Zfp574 A T 7: 25,079,898 K115M probably damaging Het
Other mutations in Tlx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1899:Tlx3 UTSW 11 33203072 missense probably benign 0.30
R6228:Tlx3 UTSW 11 33202432 missense probably benign 0.13
R6342:Tlx3 UTSW 11 33202567 missense possibly damaging 0.67
R7067:Tlx3 UTSW 11 33203204 missense probably damaging 1.00
R7290:Tlx3 UTSW 11 33203514 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTACAAAGCGGCGACTGCTCTC -3'
(R):5'- CTCTTGGCAAAGTTTCAGTGCGAC -3'

Sequencing Primer
(F):5'- CTCTCCATCCAGGGGAAATTGAG -3'
(R):5'- TTCAGTGCGACTGGAGGC -3'
Posted On2013-11-08