Incidental Mutation 'R0866:Ofcc1'
ID82362
Institutional Source Beutler Lab
Gene Symbol Ofcc1
Ensembl Gene ENSMUSG00000047094
Gene Nameorofacial cleft 1 candidate 1
SynonymsOpo, ojoplano
MMRRC Submission 039040-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0866 (G1)
Quality Score108
Status Validated
Chromosome13
Chromosomal Location40001882-40361450 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40208829 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 206 (G206R)
Ref Sequence ENSEMBL: ENSMUSP00000062217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054635] [ENSMUST00000224909]
Predicted Effect probably benign
Transcript: ENSMUST00000054635
AA Change: G206R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000062217
Gene: ENSMUSG00000047094
AA Change: G206R

DomainStartEndE-ValueType
Pfam:OFCC1 5 113 1.3e-57 PFAM
transmembrane domain 575 592 N/A INTRINSIC
transmembrane domain 599 618 N/A INTRINSIC
transmembrane domain 633 655 N/A INTRINSIC
transmembrane domain 667 689 N/A INTRINSIC
transmembrane domain 721 743 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000224909
AA Change: R180Q
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal skull morphology and normal behavior with in increase in gamma-glutamyl transpeptidase. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik G T 6: 131,552,779 R112L unknown Het
Abcd4 G T 12: 84,611,733 A232E probably damaging Het
Acsm5 T A 7: 119,540,900 I508N probably damaging Het
Adam22 T C 5: 8,082,156 Q263R probably damaging Het
Ccdc88c A G 12: 100,913,192 L1890P probably benign Het
Ckap4 C T 10: 84,527,520 D560N probably damaging Het
Crb3 T A 17: 57,062,743 L17Q probably damaging Het
Fbxo21 G T 5: 117,977,033 R78L probably benign Het
Gapvd1 A T 2: 34,709,217 C669S probably damaging Het
Gria2 A T 3: 80,722,024 probably benign Het
H2-M11 T C 17: 36,548,937 L274P probably benign Het
Hmox1 A G 8: 75,097,303 T200A probably benign Het
Hspa8 G A 9: 40,802,624 probably null Het
Isy1 C A 6: 87,819,112 R281L probably benign Het
Kiz C A 2: 146,856,053 probably benign Het
Lrig2 T C 3: 104,464,275 K704R probably benign Het
Lrp1 A T 10: 127,539,278 D4484E probably damaging Het
Lrrc7 C A 3: 158,164,266 probably benign Het
Mtmr14 T C 6: 113,239,582 probably null Het
Mtmr3 A T 11: 4,488,474 V660E probably benign Het
Mtor T C 4: 148,486,056 I1190T probably benign Het
Mtrf1l T C 10: 5,813,376 R318G probably damaging Het
Myh7 T C 14: 54,973,139 T1739A probably benign Het
Olfr186 C T 16: 59,027,428 V160I probably benign Het
Pcca A G 14: 122,889,545 E722G possibly damaging Het
Pds5b T A 5: 150,739,191 probably benign Het
Ralgapa2 A T 2: 146,436,003 F413I probably damaging Het
Rbbp9 T C 2: 144,550,708 Y24C probably damaging Het
Rgs2 A G 1: 144,002,250 S103P probably damaging Het
Rtn1 G T 12: 72,308,382 Y263* probably null Het
Slc22a1 T C 17: 12,657,046 E427G probably benign Het
Speg A G 1: 75,417,083 T1695A probably damaging Het
Tlx3 C A 11: 33,203,315 G49W probably damaging Het
Tor1b A G 2: 30,956,916 M292V probably benign Het
Tspyl3 A T 2: 153,224,934 L128Q probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfc3h1 G A 10: 115,427,716 V1821I probably benign Het
Zfhx4 A T 3: 5,412,212 T3271S possibly damaging Het
Zfp386 G T 12: 116,054,709 probably benign Het
Zfp574 A T 7: 25,079,898 K115M probably damaging Het
Other mutations in Ofcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Ofcc1 APN 13 40142804 missense probably damaging 0.97
IGL00489:Ofcc1 APN 13 40280491 missense probably damaging 1.00
IGL01952:Ofcc1 APN 13 40280861 missense probably damaging 1.00
IGL02126:Ofcc1 APN 13 40208775 missense probably benign
IGL02619:Ofcc1 APN 13 40097077 missense possibly damaging 0.68
IGL03069:Ofcc1 APN 13 40072664 missense probably benign 0.38
IGL03133:Ofcc1 APN 13 40072768 missense probably benign 0.36
IGL03273:Ofcc1 APN 13 40180525 missense probably damaging 1.00
IGL03343:Ofcc1 APN 13 40072664 missense probably benign 0.38
IGL03349:Ofcc1 APN 13 40072752 missense probably benign 0.13
IGL03399:Ofcc1 APN 13 40142838 missense possibly damaging 0.56
LCD18:Ofcc1 UTSW 13 40092967 intron probably benign
R0122:Ofcc1 UTSW 13 40280556 splice site probably null
R0320:Ofcc1 UTSW 13 40206696 missense probably benign 0.01
R0386:Ofcc1 UTSW 13 40214474 nonsense probably null
R0390:Ofcc1 UTSW 13 40015313 missense possibly damaging 0.85
R0829:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0945:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0981:Ofcc1 UTSW 13 40072698 missense probably damaging 1.00
R1055:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1056:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1186:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1187:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1400:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1411:Ofcc1 UTSW 13 40142787 missense probably benign 0.02
R1419:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1474:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1636:Ofcc1 UTSW 13 40180428 missense possibly damaging 0.86
R1691:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1886:Ofcc1 UTSW 13 40206624 missense possibly damaging 0.88
R1887:Ofcc1 UTSW 13 40206624 missense possibly damaging 0.88
R2176:Ofcc1 UTSW 13 40097119 missense probably benign
R2189:Ofcc1 UTSW 13 40180448 missense probably benign
R2242:Ofcc1 UTSW 13 40142787 missense probably benign 0.02
R2255:Ofcc1 UTSW 13 40094705 missense probably damaging 0.99
R2471:Ofcc1 UTSW 13 40097025 missense probably damaging 1.00
R2863:Ofcc1 UTSW 13 40072760 missense probably damaging 1.00
R2863:Ofcc1 UTSW 13 40087938 missense possibly damaging 0.56
R4366:Ofcc1 UTSW 13 40015461 missense probably benign 0.18
R4573:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4574:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4656:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4657:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4673:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4782:Ofcc1 UTSW 13 40001892 synonymous probably null
R4790:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4823:Ofcc1 UTSW 13 40280473 missense probably damaging 0.99
R4834:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4840:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4842:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4889:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4919:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4920:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4921:Ofcc1 UTSW 13 40214517 missense probably benign 0.10
R4948:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4953:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4961:Ofcc1 UTSW 13 40263559 critical splice donor site probably null
R5339:Ofcc1 UTSW 13 40087845 missense probably benign 0.35
R5512:Ofcc1 UTSW 13 40206810 missense probably benign 0.20
R5566:Ofcc1 UTSW 13 40094653 missense probably damaging 1.00
R5672:Ofcc1 UTSW 13 40280429 missense probably damaging 0.98
R5734:Ofcc1 UTSW 13 40087849 missense probably damaging 1.00
R5839:Ofcc1 UTSW 13 40280545 missense probably damaging 1.00
R5853:Ofcc1 UTSW 13 40206717 missense probably benign 0.00
R5896:Ofcc1 UTSW 13 40180584 missense probably benign 0.01
R5909:Ofcc1 UTSW 13 40263578 missense possibly damaging 0.92
R5995:Ofcc1 UTSW 13 40280422 missense probably damaging 1.00
R6306:Ofcc1 UTSW 13 40148576 missense probably benign
R6460:Ofcc1 UTSW 13 40287979 missense probably damaging 0.99
R6504:Ofcc1 UTSW 13 40097055 missense probably damaging 1.00
R6797:Ofcc1 UTSW 13 40087947 missense possibly damaging 0.75
R7091:Ofcc1 UTSW 13 40072767 missense probably damaging 0.99
R7098:Ofcc1 UTSW 13 40003966 critical splice donor site probably null
R7142:Ofcc1 UTSW 13 40004062 missense probably benign 0.00
R7240:Ofcc1 UTSW 13 40208841 missense probably benign
X0005:Ofcc1 UTSW 13 40142790 missense probably benign 0.01
X0005:Ofcc1 UTSW 13 40280532 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACAGCCACACAATGGATGTCTT -3'
(R):5'- ACCATGTTTAATCATGAGCAGCACCT -3'

Sequencing Primer
(F):5'- CACACAATGGATGTCTTCATCTGAC -3'
(R):5'- TCTTTCTTTCTTCGTTG -3'
Posted On2013-11-08