Incidental Mutation 'R0791:Myo6'
ID82404
Institutional Source Beutler Lab
Gene Symbol Myo6
Ensembl Gene ENSMUSG00000033577
Gene Namemyosin VI
SynonymsTlc
MMRRC Submission 038971-MU
Accession Numbers

MGI:104785

Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R0791 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location80165031-80311729 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 80262374 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035889] [ENSMUST00000076140] [ENSMUST00000113266] [ENSMUST00000113268] [ENSMUST00000127779] [ENSMUST00000184480]
Predicted Effect probably benign
Transcript: ENSMUST00000035889
SMART Domains Protein: ENSMUSP00000036181
Gene: ENSMUSG00000033577

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1134 1262 1e-74 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000076140
SMART Domains Protein: ENSMUSP00000075501
Gene: ENSMUSG00000033577

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1126 2e-27 BLAST
PDB:3H8D|D 1138 1266 8e-75 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000113266
SMART Domains Protein: ENSMUSP00000108891
Gene: ENSMUSG00000033577

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1125 1253 9e-75 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000113268
SMART Domains Protein: ENSMUSP00000108893
Gene: ENSMUSG00000033577

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1135 2e-26 BLAST
Pfam:Myosin-VI_CBD 1167 1257 1.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127779
SMART Domains Protein: ENSMUSP00000139228
Gene: ENSMUSG00000033577

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1136 1e-26 BLAST
PDB:3H8D|D 1157 1285 9e-75 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183413
Predicted Effect probably benign
Transcript: ENSMUST00000184480
SMART Domains Protein: ENSMUSP00000139019
Gene: ENSMUSG00000033577

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1145 1e-25 BLAST
PDB:3H8D|D 1166 1294 8e-75 PDB
Meta Mutation Damage Score 0.1008 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a reverse-direction motor protein that moves toward the minus end of actin filaments and plays a role in intracellular vesicle and organelle transport. The protein consists of a motor domain containing an ATP- and an actin-binding site and a globular tail which interacts with other proteins. This protein maintains the structural integrity of inner ear hair cells and mutations in this gene cause non-syndromic autosomal dominant and recessive hearing loss. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous mutant mice exhibit deafness and related behavioral characteristics such as circling, head tossing and hyperactivity. Progressive degeneration of the cochlear hair cells and the organ of Corti is observed with one mutation. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(6) Spontaneous(3) Chemically induced(2)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,933,868 probably null Het
Ahnak G A 19: 9,016,734 M5127I probably benign Het
Akr1c13 T C 13: 4,194,112 Y55H probably damaging Het
Atp2b2 C T 6: 113,773,388 R625H probably damaging Het
Bpifb2 T C 2: 153,878,519 V66A probably benign Het
Ccdc33 T C 9: 58,028,763 T950A possibly damaging Het
Ceacam19 A T 7: 19,882,632 probably null Het
Cenpn T A 8: 116,940,820 probably benign Het
Ces1f A T 8: 93,271,889 Y160N possibly damaging Het
Clca1 A C 3: 145,004,854 S863A probably benign Het
Cntrl T A 2: 35,155,279 I781K possibly damaging Het
Dock4 C T 12: 40,704,481 R490W probably damaging Het
Evpl T A 11: 116,227,723 Q686L probably damaging Het
Fbxw10 A G 11: 62,847,456 S59G probably benign Het
Glb1l2 A G 9: 26,769,751 V218A possibly damaging Het
Gpatch1 A T 7: 35,281,376 probably benign Het
Grin2c G A 11: 115,250,646 P882L probably damaging Het
H2-Ob C A 17: 34,242,614 T109N probably damaging Het
Ipo8 A G 6: 148,821,727 V64A possibly damaging Het
Jpt2 C A 17: 24,948,673 A101S probably benign Het
Lamc1 C A 1: 153,234,580 Q1116H possibly damaging Het
Lamc1 T G 1: 153,234,595 Q1111H probably damaging Het
Lamc1 T C 1: 153,234,612 S1106G probably benign Het
Large1 A G 8: 73,048,479 probably benign Het
Lig4 A T 8: 9,973,012 V256E possibly damaging Het
Mpz C A 1: 171,158,774 Q86K possibly damaging Het
Mrps24 A G 11: 5,704,684 V90A possibly damaging Het
Mtdh A G 15: 34,116,382 probably benign Het
Mtor T C 4: 148,462,910 V450A probably benign Het
Mycbpap A G 11: 94,511,623 probably null Het
Myom1 A T 17: 71,121,136 I1450F probably damaging Het
Nbas T A 12: 13,482,633 S1781T probably benign Het
Nedd1 T C 10: 92,719,614 E3G probably damaging Het
Nt5c3 T C 6: 56,886,749 T149A probably benign Het
Olfr477 A G 7: 107,990,533 H56R probably benign Het
Osbp2 G A 11: 3,711,882 probably benign Het
Paip1 T C 13: 119,430,318 S54P possibly damaging Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Prdm14 G T 1: 13,125,744 A31E probably benign Het
Ptpn14 C T 1: 189,836,440 probably benign Het
Rims2 A G 15: 39,679,625 probably benign Het
Rnf20 A G 4: 49,638,197 N103S possibly damaging Het
Sema3g T A 14: 31,220,904 probably benign Het
Slc30a6 T C 17: 74,415,645 S236P possibly damaging Het
Slc5a1 T C 5: 33,158,077 probably benign Het
Snx25 A T 8: 46,124,082 M1K probably null Het
Synpo2 A G 3: 123,113,186 V827A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trak2 A T 1: 58,903,661 M862K probably benign Het
Trim42 A T 9: 97,365,679 H321Q probably damaging Het
Twnk T C 19: 45,010,254 probably benign Het
Tymp T C 15: 89,374,818 K221R probably damaging Het
Uaca C A 9: 60,872,059 Q1243K possibly damaging Het
Vwa8 T C 14: 78,994,576 probably benign Het
Wnt4 C T 4: 137,289,283 R83W probably damaging Het
Zfp820 T C 17: 21,819,528 D273G probably benign Het
Zfp974 A T 7: 27,910,085 Y738* probably null Het
Zkscan4 A C 13: 21,483,911 E177D probably benign Het
Other mutations in Myo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Myo6 APN 9 80292472 missense probably damaging 0.98
IGL00584:Myo6 APN 9 80242273 splice site probably benign
IGL00596:Myo6 APN 9 80281743 missense possibly damaging 0.91
IGL00778:Myo6 APN 9 80283586 critical splice donor site probably null
IGL01667:Myo6 APN 9 80289893 missense unknown
IGL01939:Myo6 APN 9 80260818 missense probably damaging 1.00
IGL02123:Myo6 APN 9 80264272 splice site probably benign
IGL02271:Myo6 APN 9 80260831 missense probably benign 0.01
IGL02512:Myo6 APN 9 80292519 critical splice donor site probably null
IGL02716:Myo6 APN 9 80269694 missense probably damaging 1.00
IGL02888:Myo6 APN 9 80269731 splice site probably benign
IGL02890:Myo6 APN 9 80266174 missense probably damaging 1.00
IGL02951:Myo6 APN 9 80264234 missense possibly damaging 0.66
IGL02990:Myo6 APN 9 80276403 critical splice donor site probably null
IGL03060:Myo6 APN 9 80260877 missense probably benign 0.00
IGL03145:Myo6 APN 9 80300665 nonsense probably null
IGL03306:Myo6 APN 9 80246555 missense probably damaging 1.00
mayday_circler UTSW 9 80246451 nonsense probably null
r5101_myo6 UTSW 9 80270039 nonsense probably null
torticollis UTSW 9 80288217 critical splice donor site probably null
IGL03134:Myo6 UTSW 9 80292467 missense probably damaging 0.96
R0023:Myo6 UTSW 9 80283534 missense possibly damaging 0.62
R0023:Myo6 UTSW 9 80283534 missense possibly damaging 0.62
R0124:Myo6 UTSW 9 80307774 missense probably damaging 1.00
R0133:Myo6 UTSW 9 80273975 splice site probably benign
R0207:Myo6 UTSW 9 80288056 missense probably damaging 1.00
R0295:Myo6 UTSW 9 80283579 missense probably damaging 0.98
R0389:Myo6 UTSW 9 80292466 missense probably damaging 0.98
R0432:Myo6 UTSW 9 80273974 splice site probably benign
R0526:Myo6 UTSW 9 80283541 missense possibly damaging 0.61
R0885:Myo6 UTSW 9 80242221 missense probably damaging 1.00
R1082:Myo6 UTSW 9 80288021 missense probably damaging 1.00
R1113:Myo6 UTSW 9 80245714 missense probably damaging 1.00
R1184:Myo6 UTSW 9 80286382 nonsense probably null
R1308:Myo6 UTSW 9 80245714 missense probably damaging 1.00
R1498:Myo6 UTSW 9 80307679 missense probably damaging 1.00
R1609:Myo6 UTSW 9 80288217 critical splice donor site probably null
R1615:Myo6 UTSW 9 80307725 missense probably damaging 1.00
R1771:Myo6 UTSW 9 80285800 missense probably damaging 1.00
R1772:Myo6 UTSW 9 80270049 missense possibly damaging 0.95
R1789:Myo6 UTSW 9 80300572 missense probably damaging 1.00
R1962:Myo6 UTSW 9 80260835 missense probably damaging 1.00
R1978:Myo6 UTSW 9 80228925 missense probably damaging 0.99
R2011:Myo6 UTSW 9 80307722 missense probably damaging 0.99
R2092:Myo6 UTSW 9 80245682 missense probably damaging 1.00
R2098:Myo6 UTSW 9 80281526 missense probably damaging 1.00
R2206:Myo6 UTSW 9 80258455 missense probably benign 0.01
R2286:Myo6 UTSW 9 80266212 missense possibly damaging 0.82
R2429:Myo6 UTSW 9 80303301 critical splice donor site probably null
R2696:Myo6 UTSW 9 80260894 missense probably benign 0.00
R2897:Myo6 UTSW 9 80269611 intron probably null
R2898:Myo6 UTSW 9 80269611 intron probably null
R3881:Myo6 UTSW 9 80264256 missense probably damaging 1.00
R4424:Myo6 UTSW 9 80288038 missense probably benign 0.26
R4718:Myo6 UTSW 9 80246517 missense probably benign 0.01
R4893:Myo6 UTSW 9 80228877 missense probably damaging 1.00
R4936:Myo6 UTSW 9 80307681 missense probably damaging 1.00
R4992:Myo6 UTSW 9 80283510 missense possibly damaging 0.95
R5073:Myo6 UTSW 9 80288008 missense probably benign 0.00
R5101:Myo6 UTSW 9 80270039 nonsense probably null
R5137:Myo6 UTSW 9 80242249 missense probably damaging 1.00
R5200:Myo6 UTSW 9 80276374 nonsense probably null
R5510:Myo6 UTSW 9 80245660 missense probably damaging 1.00
R5579:Myo6 UTSW 9 80217720 missense probably damaging 0.99
R5693:Myo6 UTSW 9 80266180 missense probably damaging 1.00
R5701:Myo6 UTSW 9 80258527 missense probably damaging 1.00
R6693:Myo6 UTSW 9 80245731 missense probably damaging 1.00
R7151:Myo6 UTSW 9 80245136 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCATAGGACATTTGCATGATTGGACA -3'
(R):5'- AAGCTGAGCAGACTAATGAAAGTCACC -3'

Sequencing Primer
(F):5'- CTGATACCTAATTTTAGTGCCTGAC -3'
(R):5'- TCCTGCAAAGCAGCCTATTAAC -3'
Posted On2013-11-08