Incidental Mutation 'R0792:Sorcs3'
ID 82491
Institutional Source Beutler Lab
Gene Symbol Sorcs3
Ensembl Gene ENSMUSG00000063434
Gene Name sortilin-related VPS10 domain containing receptor 3
Synonyms 6330404A12Rik
MMRRC Submission 038972-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R0792 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 48194464-48793944 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 48694448 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 574 (T574K)
Ref Sequence ENSEMBL: ENSMUSP00000077919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078880]
AlphaFold Q8VI51
Predicted Effect possibly damaging
Transcript: ENSMUST00000078880
AA Change: T574K

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: T574K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 69 91 N/A INTRINSIC
VPS10 216 818 N/A SMART
Pfam:PKD 823 901 8e-13 PFAM
transmembrane domain 1122 1141 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,268,924 (GRCm39) V195A probably benign Het
Adgrb1 A G 15: 74,452,466 (GRCm39) M211V probably damaging Het
Ahnak G T 19: 8,994,098 (GRCm39) M5127I probably benign Het
Akr1c13 T C 13: 4,244,111 (GRCm39) Y55H probably damaging Het
Ap3d1 A T 10: 80,544,313 (GRCm39) H1161Q probably benign Het
Armh3 A T 19: 45,922,307 (GRCm39) probably null Het
Atp2b2 C T 6: 113,750,349 (GRCm39) R625H probably damaging Het
Bdnf G A 2: 109,554,463 (GRCm39) C239Y probably damaging Het
Bpifa5 G T 2: 154,007,539 (GRCm39) probably null Het
C9 T A 15: 6,516,243 (GRCm39) F349I probably damaging Het
Ccdc180 T C 4: 45,927,975 (GRCm39) V1170A possibly damaging Het
Celsr1 A G 15: 85,815,477 (GRCm39) V1846A probably benign Het
Cep68 A T 11: 20,190,652 (GRCm39) L120H possibly damaging Het
Cntrl T A 2: 35,045,291 (GRCm39) I781K possibly damaging Het
Cpne1 G T 2: 155,919,339 (GRCm39) Q343K probably benign Het
Dlc1 A T 8: 37,405,702 (GRCm39) I29K probably benign Het
Dnah9 T C 11: 65,786,827 (GRCm39) D3602G possibly damaging Het
Dock1 A G 7: 134,475,879 (GRCm39) S885G probably benign Het
Evpl T A 11: 116,118,549 (GRCm39) Q686L probably damaging Het
Fmo6 C T 1: 162,748,132 (GRCm39) A311T probably damaging Het
Gli1 A T 10: 127,168,446 (GRCm39) M469K probably damaging Het
Grin2c G A 11: 115,141,472 (GRCm39) P882L probably damaging Het
H2-Ob C T 17: 34,461,588 (GRCm39) T109I probably damaging Het
Jpt2 C A 17: 25,167,647 (GRCm39) A101S probably benign Het
Krt1c A G 15: 101,724,932 (GRCm39) V226A probably damaging Het
Lamc1 T C 1: 153,110,358 (GRCm39) S1106G probably benign Het
Lamc1 C A 1: 153,110,326 (GRCm39) Q1116H possibly damaging Het
Lamc1 T G 1: 153,110,341 (GRCm39) Q1111H probably damaging Het
Lrp1 G T 10: 127,403,233 (GRCm39) D2113E probably damaging Het
Lrp1 A T 10: 127,411,155 (GRCm39) D1399E probably benign Het
Ltbp4 G T 7: 27,024,485 (GRCm39) P715Q probably damaging Het
Mtor T C 4: 148,547,367 (GRCm39) V450A probably benign Het
Muc6 G A 7: 141,223,981 (GRCm39) probably benign Het
Myom1 A T 17: 71,428,131 (GRCm39) I1450F probably damaging Het
Naip6 A G 13: 100,420,274 (GRCm39) I1332T possibly damaging Het
Ncstn A G 1: 171,899,072 (GRCm39) V353A possibly damaging Het
Nt5c3 T C 6: 56,863,734 (GRCm39) T149A probably benign Het
Or5ac21 A T 16: 59,124,352 (GRCm39) I280F probably damaging Het
Or5p81 A G 7: 108,267,364 (GRCm39) H247R probably damaging Het
Paip1 T C 13: 119,566,854 (GRCm39) S54P possibly damaging Het
Prdm14 G T 1: 13,195,968 (GRCm39) A31E probably benign Het
Prr14l A G 5: 32,985,767 (GRCm39) S1243P probably damaging Het
Prss1 T C 6: 41,435,878 (GRCm39) M1T probably null Het
Raver2 T A 4: 100,960,147 (GRCm39) V209D probably damaging Het
Scube1 T A 15: 83,512,277 (GRCm39) probably null Het
Serpina3c T A 12: 104,117,805 (GRCm39) I178F probably damaging Het
Slc16a13 A T 11: 70,111,457 (GRCm39) V16E probably damaging Het
Slc30a6 T C 17: 74,722,640 (GRCm39) S236P possibly damaging Het
Sobp A C 10: 42,898,689 (GRCm39) S299A probably damaging Het
Trak2 A T 1: 58,942,820 (GRCm39) M862K probably benign Het
Ubox5 A T 2: 130,442,630 (GRCm39) V19E probably damaging Het
Vmn1r173 A G 7: 23,402,160 (GRCm39) T132A probably benign Het
Zfp267 A G 3: 36,218,711 (GRCm39) M244V probably benign Het
Zfp820 T C 17: 22,038,509 (GRCm39) D273G probably benign Het
Other mutations in Sorcs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sorcs3 APN 19 48,672,097 (GRCm39) critical splice donor site probably null
IGL00233:Sorcs3 APN 19 48,736,758 (GRCm39) missense probably benign 0.12
IGL00482:Sorcs3 APN 19 48,592,303 (GRCm39) missense probably benign 0.00
IGL00976:Sorcs3 APN 19 48,755,542 (GRCm39) missense probably damaging 1.00
IGL01367:Sorcs3 APN 19 48,784,814 (GRCm39) missense probably damaging 1.00
IGL01390:Sorcs3 APN 19 48,778,570 (GRCm39) missense probably damaging 1.00
IGL01548:Sorcs3 APN 19 48,782,607 (GRCm39) missense possibly damaging 0.87
IGL02162:Sorcs3 APN 19 48,523,970 (GRCm39) missense probably damaging 0.98
IGL02165:Sorcs3 APN 19 48,642,511 (GRCm39) missense probably benign 0.03
IGL02404:Sorcs3 APN 19 48,692,809 (GRCm39) splice site probably benign
IGL02830:Sorcs3 APN 19 48,711,441 (GRCm39) splice site probably null
IGL02943:Sorcs3 APN 19 48,748,377 (GRCm39) missense probably benign 0.00
R0371:Sorcs3 UTSW 19 48,592,333 (GRCm39) missense probably benign 0.00
R0456:Sorcs3 UTSW 19 48,642,483 (GRCm39) missense possibly damaging 0.94
R0466:Sorcs3 UTSW 19 48,736,758 (GRCm39) missense probably benign 0.12
R0470:Sorcs3 UTSW 19 48,785,956 (GRCm39) critical splice donor site probably null
R0536:Sorcs3 UTSW 19 48,791,137 (GRCm39) nonsense probably null
R0646:Sorcs3 UTSW 19 48,194,734 (GRCm39) missense probably benign 0.10
R0709:Sorcs3 UTSW 19 48,475,845 (GRCm39) missense probably benign
R0831:Sorcs3 UTSW 19 48,682,433 (GRCm39) missense probably damaging 1.00
R0836:Sorcs3 UTSW 19 48,475,833 (GRCm39) missense probably benign
R1253:Sorcs3 UTSW 19 48,195,175 (GRCm39) missense possibly damaging 0.67
R1390:Sorcs3 UTSW 19 48,682,440 (GRCm39) critical splice donor site probably null
R1522:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R1570:Sorcs3 UTSW 19 48,752,620 (GRCm39) missense probably damaging 1.00
R1637:Sorcs3 UTSW 19 48,736,798 (GRCm39) critical splice donor site probably null
R1766:Sorcs3 UTSW 19 48,592,314 (GRCm39) missense possibly damaging 0.87
R1894:Sorcs3 UTSW 19 48,782,713 (GRCm39) missense probably benign 0.23
R2426:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R3789:Sorcs3 UTSW 19 48,387,150 (GRCm39) missense possibly damaging 0.46
R3818:Sorcs3 UTSW 19 48,592,343 (GRCm39) missense probably benign 0.00
R3824:Sorcs3 UTSW 19 48,711,395 (GRCm39) missense probably damaging 1.00
R3934:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R3936:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R4190:Sorcs3 UTSW 19 48,737,812 (GRCm39) missense possibly damaging 0.69
R4604:Sorcs3 UTSW 19 48,682,353 (GRCm39) missense probably benign 0.35
R4644:Sorcs3 UTSW 19 48,672,036 (GRCm39) missense probably damaging 1.00
R4774:Sorcs3 UTSW 19 48,782,602 (GRCm39) missense probably benign 0.23
R4801:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4802:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4945:Sorcs3 UTSW 19 48,752,587 (GRCm39) missense possibly damaging 0.50
R5049:Sorcs3 UTSW 19 48,748,390 (GRCm39) missense possibly damaging 0.93
R5175:Sorcs3 UTSW 19 48,748,284 (GRCm39) critical splice acceptor site probably null
R5342:Sorcs3 UTSW 19 48,784,911 (GRCm39) splice site probably null
R5848:Sorcs3 UTSW 19 48,776,950 (GRCm39) missense probably damaging 1.00
R5959:Sorcs3 UTSW 19 48,737,835 (GRCm39) missense probably damaging 1.00
R5977:Sorcs3 UTSW 19 48,784,889 (GRCm39) missense probably damaging 1.00
R6155:Sorcs3 UTSW 19 48,387,136 (GRCm39) missense possibly damaging 0.94
R6222:Sorcs3 UTSW 19 48,748,296 (GRCm39) missense possibly damaging 0.57
R6268:Sorcs3 UTSW 19 48,778,605 (GRCm39) missense probably damaging 1.00
R6416:Sorcs3 UTSW 19 48,791,198 (GRCm39) missense probably damaging 1.00
R6425:Sorcs3 UTSW 19 48,752,746 (GRCm39) critical splice donor site probably null
R6623:Sorcs3 UTSW 19 48,776,944 (GRCm39) missense probably benign 0.00
R6767:Sorcs3 UTSW 19 48,702,010 (GRCm39) missense probably damaging 0.99
R6888:Sorcs3 UTSW 19 48,682,263 (GRCm39) missense possibly damaging 0.83
R6955:Sorcs3 UTSW 19 48,737,782 (GRCm39) missense possibly damaging 0.82
R7106:Sorcs3 UTSW 19 48,694,402 (GRCm39) missense probably damaging 1.00
R7379:Sorcs3 UTSW 19 48,760,705 (GRCm39) missense possibly damaging 0.69
R7953:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8043:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8242:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8343:Sorcs3 UTSW 19 48,692,808 (GRCm39) splice site probably null
R8433:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8435:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8436:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8940:Sorcs3 UTSW 19 48,784,908 (GRCm39) critical splice donor site probably null
R8956:Sorcs3 UTSW 19 48,737,810 (GRCm39) nonsense probably null
R9051:Sorcs3 UTSW 19 48,194,809 (GRCm39) missense probably benign
R9119:Sorcs3 UTSW 19 48,642,433 (GRCm39) missense possibly damaging 0.92
R9166:Sorcs3 UTSW 19 48,784,811 (GRCm39) missense probably benign 0.01
R9328:Sorcs3 UTSW 19 48,785,950 (GRCm39) missense probably damaging 1.00
R9489:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9605:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9757:Sorcs3 UTSW 19 48,711,363 (GRCm39) missense probably damaging 1.00
X0018:Sorcs3 UTSW 19 48,760,728 (GRCm39) missense probably damaging 1.00
Z1176:Sorcs3 UTSW 19 48,634,243 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs3 UTSW 19 48,692,739 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCTCTTATCATGCAGGGCAAG -3'
(R):5'- GGCCTTTCACTAGATGCAGAGGAC -3'

Sequencing Primer
(F):5'- CAGGGCAAGGGTATGGC -3'
(R):5'- CTTTGGGACAGGATGAATTAACC -3'
Posted On 2013-11-08