Incidental Mutation 'R0850:Herc6'
ID82512
Institutional Source Beutler Lab
Gene Symbol Herc6
Ensembl Gene ENSMUSG00000029798
Gene Namehect domain and RLD 6
SynonymsHerc5, 1700121D12Rik, CEB1, 2510038N07Rik, 4930427L17Rik
MMRRC Submission 039029-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0850 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location57581000-57664632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57583242 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 89 (V89A)
Ref Sequence ENSEMBL: ENSMUSP00000031817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031817] [ENSMUST00000203840]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031817
AA Change: V89A

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031817
Gene: ENSMUSG00000029798
AA Change: V89A

DomainStartEndE-ValueType
Pfam:RCC1 40 89 1.9e-12 PFAM
Pfam:RCC1 92 142 4.8e-17 PFAM
Pfam:RCC1_2 129 158 3.4e-14 PFAM
Pfam:RCC1 145 195 1.6e-18 PFAM
Pfam:RCC1_2 183 211 1e-8 PFAM
Pfam:RCC1 198 250 2e-10 PFAM
Pfam:RCC1_2 237 266 4e-10 PFAM
Pfam:RCC1 253 301 4.8e-9 PFAM
low complexity region 359 373 N/A INTRINSIC
low complexity region 611 626 N/A INTRINSIC
HECTc 677 1003 1.03e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203840
SMART Domains Protein: ENSMUSP00000145505
Gene: ENSMUSG00000029798

DomainStartEndE-ValueType
Pfam:RCC1 40 78 2.2e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204686
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HERC6 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016C15Rik A G 1: 177,741,005 T23A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
9330182L06Rik T A 5: 9,417,993 N220K probably damaging Het
Agbl3 T A 6: 34,799,204 F210Y probably damaging Het
Dgkq A G 5: 108,654,578 V418A possibly damaging Het
Dmp1 A T 5: 104,212,787 D443V possibly damaging Het
Elavl3 T G 9: 22,036,763 D35A probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fbxw25 T C 9: 109,649,617 K425R probably benign Het
Gm5538 T G 3: 59,752,248 I374R possibly damaging Het
Gypa A G 8: 80,496,345 H26R unknown Het
H2-DMb1 T C 17: 34,155,562 V62A probably benign Het
Helb T C 10: 120,105,367 H472R probably damaging Het
Herc1 T G 9: 66,466,670 V3197G probably damaging Het
Herc2 C A 7: 56,204,483 N3712K probably benign Het
Hspa1l A G 17: 34,977,623 T213A probably benign Het
Kcna7 T C 7: 45,409,431 S381P probably damaging Het
Kif19a C A 11: 114,780,787 P164Q probably damaging Het
Macf1 A G 4: 123,474,402 S2189P probably benign Het
Mpo A G 11: 87,797,502 N329S probably damaging Het
Mrps15 A G 4: 126,048,686 Y76C probably damaging Het
Olfr643 T A 7: 104,059,045 M186L probably benign Het
Olfr790 T C 10: 129,501,724 V280A probably damaging Het
Prdm2 T C 4: 143,132,203 R1506G possibly damaging Het
Ptprb A T 10: 116,302,125 Q311H possibly damaging Het
Ptprb T C 10: 116,339,510 Y1137H probably damaging Het
Scaf8 A G 17: 3,195,774 probably null Het
Slc25a1 A T 16: 17,927,281 F105Y probably benign Het
Slc29a4 T C 5: 142,718,572 V327A probably benign Het
Tmed10 A G 12: 85,343,505 F195L probably benign Het
Tmem45a2 T A 16: 57,045,369 I151F probably benign Het
Vmn2r93 C A 17: 18,305,017 F312L possibly damaging Het
Zfp326 A G 5: 105,878,797 probably null Het
Other mutations in Herc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Herc6 APN 6 57607145 missense probably benign 0.03
IGL00836:Herc6 APN 6 57619549 missense probably damaging 0.98
IGL01289:Herc6 APN 6 57598623 missense probably damaging 1.00
IGL01631:Herc6 APN 6 57604107 missense probably benign 0.03
IGL02656:Herc6 APN 6 57611836 critical splice donor site probably null
IGL02966:Herc6 APN 6 57583333 critical splice donor site probably null
IGL03297:Herc6 APN 6 57662389 missense probably benign 0.03
IGL02835:Herc6 UTSW 6 57646161 missense possibly damaging 0.94
R0218:Herc6 UTSW 6 57619601 missense probably benign 0.00
R0470:Herc6 UTSW 6 57619452 missense probably damaging 1.00
R0699:Herc6 UTSW 6 57581107 missense probably damaging 1.00
R0702:Herc6 UTSW 6 57581107 missense probably damaging 1.00
R0707:Herc6 UTSW 6 57662362 missense possibly damaging 0.81
R1067:Herc6 UTSW 6 57662219 missense probably damaging 1.00
R1740:Herc6 UTSW 6 57652065 missense probably benign
R1840:Herc6 UTSW 6 57658106 nonsense probably null
R1889:Herc6 UTSW 6 57662075 nonsense probably null
R1938:Herc6 UTSW 6 57625941 missense probably damaging 1.00
R2024:Herc6 UTSW 6 57583332 missense probably benign 0.04
R2051:Herc6 UTSW 6 57625976 missense probably benign 0.00
R2238:Herc6 UTSW 6 57654401 missense probably benign 0.05
R2244:Herc6 UTSW 6 57598617 nonsense probably null
R4085:Herc6 UTSW 6 57647069 missense probably benign 0.09
R4410:Herc6 UTSW 6 57659679 missense possibly damaging 0.82
R4490:Herc6 UTSW 6 57654495 missense probably damaging 1.00
R4599:Herc6 UTSW 6 57659713 missense probably benign 0.34
R4716:Herc6 UTSW 6 57598438 missense probably damaging 1.00
R4757:Herc6 UTSW 6 57600060 critical splice donor site probably null
R4761:Herc6 UTSW 6 57662900 missense probably benign 0.01
R4798:Herc6 UTSW 6 57604166 missense probably damaging 1.00
R4826:Herc6 UTSW 6 57647087 missense probably benign 0.00
R5520:Herc6 UTSW 6 57647120 missense possibly damaging 0.51
R5545:Herc6 UTSW 6 57658007 critical splice acceptor site probably null
R5664:Herc6 UTSW 6 57618684 missense probably benign
R5763:Herc6 UTSW 6 57662887 missense probably damaging 1.00
R5916:Herc6 UTSW 6 57646203 missense probably benign
R6115:Herc6 UTSW 6 57583206 missense probably benign 0.01
R6225:Herc6 UTSW 6 57662154 missense possibly damaging 0.50
R7319:Herc6 UTSW 6 57604089 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAATTCCTGTCTTAAACTCCAGACAT -3'
(R):5'- AACCCTTACACTAGTAATCTCTGTGCCA -3'

Sequencing Primer
(F):5'- tctctccctttctttctttctttttc -3'
(R):5'- GTGCCATGGCATTTGAGTAC -3'
Posted On2013-11-08