Incidental Mutation 'R0850:Kif19a'
ID82529
Institutional Source Beutler Lab
Gene Symbol Kif19a
Ensembl Gene ENSMUSG00000010021
Gene Namekinesin family member 19A
SynonymsN-8 kinesin
MMRRC Submission 039029-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R0850 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location114765388-114790739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 114780787 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 164 (P164Q)
Ref Sequence ENSEMBL: ENSMUSP00000081398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084368] [ENSMUST00000138804]
Predicted Effect probably damaging
Transcript: ENSMUST00000084368
AA Change: P164Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081398
Gene: ENSMUSG00000010021
AA Change: P164Q

DomainStartEndE-ValueType
KISc 9 354 4.53e-150 SMART
coiled coil region 361 388 N/A INTRINSIC
coiled coil region 431 449 N/A INTRINSIC
coiled coil region 506 551 N/A INTRINSIC
low complexity region 628 641 N/A INTRINSIC
low complexity region 750 766 N/A INTRINSIC
low complexity region 807 815 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137326
Predicted Effect probably benign
Transcript: ENSMUST00000138804
SMART Domains Protein: ENSMUSP00000115663
Gene: ENSMUSG00000010021

DomainStartEndE-ValueType
KISc 9 312 2.99e-118 SMART
coiled coil region 319 346 N/A INTRINSIC
coiled coil region 389 407 N/A INTRINSIC
coiled coil region 464 509 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 683 692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display partial postnatal lethality, hydroencephaly, female infertility, oviduct obstruction, increased motile cilium length and impaired motile cilium movement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016C15Rik A G 1: 177,741,005 T23A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
9330182L06Rik T A 5: 9,417,993 N220K probably damaging Het
Agbl3 T A 6: 34,799,204 F210Y probably damaging Het
Dgkq A G 5: 108,654,578 V418A possibly damaging Het
Dmp1 A T 5: 104,212,787 D443V possibly damaging Het
Elavl3 T G 9: 22,036,763 D35A probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fbxw25 T C 9: 109,649,617 K425R probably benign Het
Gm5538 T G 3: 59,752,248 I374R possibly damaging Het
Gypa A G 8: 80,496,345 H26R unknown Het
H2-DMb1 T C 17: 34,155,562 V62A probably benign Het
Helb T C 10: 120,105,367 H472R probably damaging Het
Herc1 T G 9: 66,466,670 V3197G probably damaging Het
Herc2 C A 7: 56,204,483 N3712K probably benign Het
Herc6 T C 6: 57,583,242 V89A possibly damaging Het
Hspa1l A G 17: 34,977,623 T213A probably benign Het
Kcna7 T C 7: 45,409,431 S381P probably damaging Het
Macf1 A G 4: 123,474,402 S2189P probably benign Het
Mpo A G 11: 87,797,502 N329S probably damaging Het
Mrps15 A G 4: 126,048,686 Y76C probably damaging Het
Olfr643 T A 7: 104,059,045 M186L probably benign Het
Olfr790 T C 10: 129,501,724 V280A probably damaging Het
Prdm2 T C 4: 143,132,203 R1506G possibly damaging Het
Ptprb A T 10: 116,302,125 Q311H possibly damaging Het
Ptprb T C 10: 116,339,510 Y1137H probably damaging Het
Scaf8 A G 17: 3,195,774 probably null Het
Slc25a1 A T 16: 17,927,281 F105Y probably benign Het
Slc29a4 T C 5: 142,718,572 V327A probably benign Het
Tmed10 A G 12: 85,343,505 F195L probably benign Het
Tmem45a2 T A 16: 57,045,369 I151F probably benign Het
Vmn2r93 C A 17: 18,305,017 F312L possibly damaging Het
Zfp326 A G 5: 105,878,797 probably null Het
Other mutations in Kif19a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Kif19a APN 11 114779585 missense probably damaging 1.00
IGL00743:Kif19a APN 11 114784773 missense probably damaging 1.00
IGL00763:Kif19a APN 11 114767168 missense probably benign 0.00
IGL01327:Kif19a APN 11 114781799 splice site probably benign
IGL02422:Kif19a APN 11 114789361 missense probably damaging 1.00
IGL02481:Kif19a APN 11 114789153 missense probably benign 0.28
IGL02496:Kif19a APN 11 114779644 missense probably damaging 0.99
IGL02735:Kif19a APN 11 114785567 missense probably damaging 1.00
IGL02830:Kif19a APN 11 114781208 missense probably damaging 1.00
IGL02902:Kif19a APN 11 114785570 missense possibly damaging 0.46
IGL03372:Kif19a APN 11 114779218 missense probably damaging 0.99
PIT4520001:Kif19a UTSW 11 114781208 missense probably damaging 1.00
R0212:Kif19a UTSW 11 114784910 missense possibly damaging 0.48
R0383:Kif19a UTSW 11 114765514 start codon destroyed possibly damaging 0.63
R1343:Kif19a UTSW 11 114785827 missense probably benign 0.08
R1422:Kif19a UTSW 11 114785809 missense probably benign 0.01
R1547:Kif19a UTSW 11 114786572 missense probably benign 0.41
R1591:Kif19a UTSW 11 114789231 missense probably benign
R2148:Kif19a UTSW 11 114780768 missense probably damaging 1.00
R2291:Kif19a UTSW 11 114790193 missense probably damaging 1.00
R3814:Kif19a UTSW 11 114781919 missense probably damaging 1.00
R3944:Kif19a UTSW 11 114786735 missense probably benign 0.34
R4631:Kif19a UTSW 11 114784847 missense possibly damaging 0.95
R4866:Kif19a UTSW 11 114767227 missense probably benign 0.00
R4867:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5022:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5071:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5072:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5073:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5074:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5091:Kif19a UTSW 11 114783097 missense probably damaging 1.00
R5640:Kif19a UTSW 11 114779215 missense probably benign 0.25
R5646:Kif19a UTSW 11 114779654 missense probably damaging 1.00
R5786:Kif19a UTSW 11 114779223 nonsense probably null
R5890:Kif19a UTSW 11 114789438 missense possibly damaging 0.92
R6344:Kif19a UTSW 11 114781951 critical splice donor site probably null
R6522:Kif19a UTSW 11 114785779 missense probably damaging 1.00
R6570:Kif19a UTSW 11 114784905 missense possibly damaging 0.63
R6879:Kif19a UTSW 11 114781333 missense probably benign 0.03
R7028:Kif19a UTSW 11 114781208 missense probably damaging 1.00
R7274:Kif19a UTSW 11 114765455 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCAAACAGACGCACATGGTCCTTC -3'
(R):5'- GGCATTTCTCTGCAAGCAGGTCTC -3'

Sequencing Primer
(F):5'- GCACATGGTCCTTCCTTTCTTAG -3'
(R):5'- GCAAGCAGGTCTCTCTGTAAATG -3'
Posted On2013-11-08