Incidental Mutation 'R0850:H2-DMb1'
ID82536
Institutional Source Beutler Lab
Gene Symbol H2-DMb1
Ensembl Gene ENSMUSG00000079547
Gene Namehistocompatibility 2, class II, locus Mb1
SynonymsH2-M beta1, H2-Mb1, H-2Mb1
MMRRC Submission 039029-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R0850 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34153072-34160230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34155562 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 62 (V62A)
Ref Sequence ENSEMBL: ENSMUSP00000109870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041982] [ENSMUST00000114232] [ENSMUST00000171231]
Predicted Effect probably benign
Transcript: ENSMUST00000041982
SMART Domains Protein: ENSMUSP00000043526
Gene: ENSMUSG00000037548

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
MHC_II_beta 27 105 7.87e-27 SMART
IGc1 130 202 9.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114232
AA Change: V62A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109870
Gene: ENSMUSG00000079547
AA Change: V62A

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
MHC_II_beta 27 105 3.45e-23 SMART
IGc1 130 202 9.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171231
SMART Domains Protein: ENSMUSP00000126533
Gene: ENSMUSG00000037548

DomainStartEndE-ValueType
IGc1 2 71 6.48e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174765
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016C15Rik A G 1: 177,741,005 T23A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
9330182L06Rik T A 5: 9,417,993 N220K probably damaging Het
Agbl3 T A 6: 34,799,204 F210Y probably damaging Het
Dgkq A G 5: 108,654,578 V418A possibly damaging Het
Dmp1 A T 5: 104,212,787 D443V possibly damaging Het
Elavl3 T G 9: 22,036,763 D35A probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fbxw25 T C 9: 109,649,617 K425R probably benign Het
Gm5538 T G 3: 59,752,248 I374R possibly damaging Het
Gypa A G 8: 80,496,345 H26R unknown Het
Helb T C 10: 120,105,367 H472R probably damaging Het
Herc1 T G 9: 66,466,670 V3197G probably damaging Het
Herc2 C A 7: 56,204,483 N3712K probably benign Het
Herc6 T C 6: 57,583,242 V89A possibly damaging Het
Hspa1l A G 17: 34,977,623 T213A probably benign Het
Kcna7 T C 7: 45,409,431 S381P probably damaging Het
Kif19a C A 11: 114,780,787 P164Q probably damaging Het
Macf1 A G 4: 123,474,402 S2189P probably benign Het
Mpo A G 11: 87,797,502 N329S probably damaging Het
Mrps15 A G 4: 126,048,686 Y76C probably damaging Het
Olfr643 T A 7: 104,059,045 M186L probably benign Het
Olfr790 T C 10: 129,501,724 V280A probably damaging Het
Prdm2 T C 4: 143,132,203 R1506G possibly damaging Het
Ptprb A T 10: 116,302,125 Q311H possibly damaging Het
Ptprb T C 10: 116,339,510 Y1137H probably damaging Het
Scaf8 A G 17: 3,195,774 probably null Het
Slc25a1 A T 16: 17,927,281 F105Y probably benign Het
Slc29a4 T C 5: 142,718,572 V327A probably benign Het
Tmed10 A G 12: 85,343,505 F195L probably benign Het
Tmem45a2 T A 16: 57,045,369 I151F probably benign Het
Vmn2r93 C A 17: 18,305,017 F312L possibly damaging Het
Zfp326 A G 5: 105,878,797 probably null Het
Other mutations in H2-DMb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03356:H2-DMb1 APN 17 34157540 splice site probably benign
R0374:H2-DMb1 UTSW 17 34159425 missense probably benign 0.08
R0436:H2-DMb1 UTSW 17 34159656 missense probably damaging 1.00
R0454:H2-DMb1 UTSW 17 34155711 missense probably benign 0.32
R2355:H2-DMb1 UTSW 17 34157315 missense probably damaging 1.00
R4211:H2-DMb1 UTSW 17 34155573 missense possibly damaging 0.87
R5786:H2-DMb1 UTSW 17 34153434 missense possibly damaging 0.73
R6125:H2-DMb1 UTSW 17 34157465 missense probably damaging 1.00
R6313:H2-DMb1 UTSW 17 34157532 critical splice donor site probably null
R6385:H2-DMb1 UTSW 17 34155602 missense probably benign 0.00
R6993:H2-DMb1 UTSW 17 34157350 missense possibly damaging 0.95
R7207:H2-DMb1 UTSW 17 34157516 missense probably damaging 0.99
R7324:H2-DMb1 UTSW 17 34159462 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATCCTGCCATGCAGACTCTGACC -3'
(R):5'- TGCCCAGGTATTAACCCCTTTGTTG -3'

Sequencing Primer
(F):5'- GCAGACTCTGACCTGCCTTC -3'
(R):5'- GGTATTAACCCCTTTGTTGCTCAAG -3'
Posted On2013-11-08