Incidental Mutation 'R0941:Trim9'
ID82592
Institutional Source Beutler Lab
Gene Symbol Trim9
Ensembl Gene ENSMUSG00000021071
Gene Nametripartite motif-containing 9
Synonyms
MMRRC Submission 039080-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R0941 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location70244533-70347614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70248263 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 787 (V787A)
Ref Sequence ENSEMBL: ENSMUSP00000152147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110520] [ENSMUST00000110522] [ENSMUST00000222316] [ENSMUST00000223160]
Predicted Effect probably benign
Transcript: ENSMUST00000110520
SMART Domains Protein: ENSMUSP00000106149
Gene: ENSMUSG00000021071

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
Pfam:SPRY 598 702 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110522
SMART Domains Protein: ENSMUSP00000106151
Gene: ENSMUSG00000021071

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
low complexity region 591 605 N/A INTRINSIC
Pfam:SPRY 674 776 1.5e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000221294
AA Change: V741A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222173
Predicted Effect probably damaging
Transcript: ENSMUST00000222316
AA Change: V787A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000223160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223518
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display increased axonal branching and increased corpus callosum thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 G T 18: 74,798,343 M203I probably benign Het
Afmid T A 11: 117,835,245 probably benign Het
Ahnak A G 19: 9,009,914 D2854G probably damaging Het
Amotl1 A C 9: 14,596,558 I31S possibly damaging Het
Arf3 A G 15: 98,741,103 V91A probably benign Het
Atp1b1 A C 1: 164,443,260 I50S probably benign Het
Baz1a A T 12: 54,898,431 S1380T probably benign Het
C4b T A 17: 34,740,055 T467S probably benign Het
Casd1 T C 6: 4,635,848 S640P probably damaging Het
Col4a1 C T 8: 11,208,296 G1396S unknown Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam160a1 G T 3: 85,673,059 P613Q probably benign Het
Gm12695 C A 4: 96,728,217 E460* probably null Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Igsf8 C T 1: 172,316,396 R39C probably damaging Het
Kdm3b T A 18: 34,803,552 C296S probably damaging Het
Lama1 C T 17: 67,775,865 P1373S probably benign Het
Lamc1 A G 1: 153,332,274 L89P possibly damaging Het
Ltc4s T G 11: 50,237,442 probably null Het
Met A T 6: 17,491,394 I52F probably damaging Het
Mterf2 G A 10: 85,120,070 T230M possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Npr1 A T 3: 90,461,409 I448N probably benign Het
Olfr654 C T 7: 104,588,338 T178I probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Serpini1 A T 3: 75,616,627 I181F probably damaging Het
Shc3 T C 13: 51,480,206 M88V probably benign Het
Skint6 T A 4: 113,238,358 S35C probably damaging Het
Spta1 T C 1: 174,245,205 probably benign Het
Sult2a2 C T 7: 13,734,890 R94* probably null Het
Ttn A G 2: 76,719,023 V31770A probably benign Het
Unc5d T C 8: 28,759,027 N337D possibly damaging Het
Vmn2r7 A T 3: 64,716,579 Y107N probably benign Het
Other mutations in Trim9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Trim9 APN 12 70347113 missense probably damaging 0.98
IGL01618:Trim9 APN 12 70248351 missense probably benign
IGL01794:Trim9 APN 12 70281880 missense probably damaging 1.00
IGL03101:Trim9 APN 12 70346654 missense probably damaging 1.00
IGL03184:Trim9 APN 12 70251221 missense probably damaging 0.99
E0354:Trim9 UTSW 12 70272459 missense probably benign 0.01
IGL03098:Trim9 UTSW 12 70280693 missense possibly damaging 0.95
R0518:Trim9 UTSW 12 70346585 missense probably damaging 0.99
R0622:Trim9 UTSW 12 70346604 missense probably damaging 1.00
R1022:Trim9 UTSW 12 70252017 splice site probably null
R1024:Trim9 UTSW 12 70252017 splice site probably null
R1204:Trim9 UTSW 12 70346727 missense probably damaging 1.00
R1439:Trim9 UTSW 12 70251093 missense probably damaging 1.00
R1530:Trim9 UTSW 12 70272428 missense probably damaging 0.98
R1613:Trim9 UTSW 12 70248395 missense probably damaging 1.00
R1661:Trim9 UTSW 12 70255113 missense probably damaging 0.99
R1665:Trim9 UTSW 12 70255113 missense probably damaging 0.99
R1722:Trim9 UTSW 12 70248374 missense probably benign 0.33
R2097:Trim9 UTSW 12 70347159 missense probably damaging 1.00
R3082:Trim9 UTSW 12 70255113 missense possibly damaging 0.93
R3123:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3124:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3125:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3738:Trim9 UTSW 12 70251195 missense probably damaging 1.00
R4013:Trim9 UTSW 12 70346352 missense probably damaging 1.00
R4017:Trim9 UTSW 12 70346352 missense probably damaging 1.00
R4560:Trim9 UTSW 12 70347118 nonsense probably null
R4734:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4748:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4749:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4777:Trim9 UTSW 12 70347071 missense probably damaging 1.00
R5027:Trim9 UTSW 12 70346708 missense probably damaging 0.96
R5451:Trim9 UTSW 12 70346829 missense probably benign 0.17
R5471:Trim9 UTSW 12 70346792 missense possibly damaging 0.93
R6394:Trim9 UTSW 12 70255213 missense possibly damaging 0.91
R6901:Trim9 UTSW 12 70346639 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCAGCTCACACTTCTGATAAGTGCC -3'
(R):5'- GATGAAAGCAAGCCGACGACATTC -3'

Sequencing Primer
(F):5'- AGCAGCCAGTCTGTTGAAGTC -3'
(R):5'- GCCGACGACATTCCACTTTTTC -3'
Posted On2013-11-08