Incidental Mutation 'R0854:Alox12b'
ID82664
Institutional Source Beutler Lab
Gene Symbol Alox12b
Ensembl Gene ENSMUSG00000032807
Gene Namearachidonate 12-lipoxygenase, 12R type
Synonymse-LOX2, 12R-LOX, Aloxe2
MMRRC Submission 039033-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0854 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69156989-69169792 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 69164476 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036424]
Predicted Effect probably null
Transcript: ENSMUST00000036424
SMART Domains Protein: ENSMUSP00000035250
Gene: ENSMUSG00000032807

DomainStartEndE-ValueType
LH2 2 116 9.9e-32 SMART
low complexity region 164 175 N/A INTRINSIC
Pfam:Lipoxygenase 228 686 5.3e-59 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme involved in the conversion of arachidonic acid to 12R-hydroxyeicosatetraenoic acid. Mutations in this gene can prevent the formation of the epidermal permeability barrier and cause an ichthyosiform phenotype. [provided by RefSeq, Sep 2015]
PHENOTYPE: Neonatal homozygous mutant mice exhibit reddened skin that quickly dehydrates and appears scaly. The epidermis is hyperkeratotic, and its permeability barrier function is compromised. Homozygotes die within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brox T G 1: 183,287,758 R128S possibly damaging Het
Cfap57 G A 4: 118,561,872 T1153I probably benign Het
Ddt C T 10: 75,771,495 R54H probably benign Het
Epm2aip1 T A 9: 111,272,499 L180* probably null Het
Fer1l6 A G 15: 58,559,188 I231V probably benign Het
Gng7 A G 10: 80,951,673 V52A possibly damaging Het
Hbb-bh2 T C 7: 103,840,065 H93R probably damaging Het
Muc4 A T 16: 32,778,955 H3292L possibly damaging Het
Mybpc2 T C 7: 44,517,002 E188G probably benign Het
Myh4 T C 11: 67,259,147 L1844P possibly damaging Het
Ncan G T 8: 70,112,552 R242S probably damaging Het
Nceh1 T A 3: 27,241,319 L243Q probably damaging Het
Notch4 T A 17: 34,568,572 S369T probably damaging Het
P3h3 G T 6: 124,854,933 D296E probably benign Het
Pask T A 1: 93,327,400 K316M probably damaging Het
Pask T C 1: 93,327,412 K312R probably damaging Het
Pask T A 1: 93,327,434 T305S possibly damaging Het
Pgbd1 A G 13: 21,423,172 V284A probably damaging Het
Sec24c A G 14: 20,689,340 Y40C probably damaging Het
Sema6d C T 2: 124,665,302 T1010M probably damaging Het
Thsd1 G A 8: 22,258,571 G433E probably damaging Het
Tnfsf18 T A 1: 161,503,668 I129N probably damaging Het
Tsc22d1 C T 14: 76,418,201 Q625* probably null Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r58 T G 7: 41,837,138 N778H probably damaging Het
Wdr17 C T 8: 54,703,881 V7I probably benign Het
Zranb1 T C 7: 132,949,848 V102A possibly damaging Het
Other mutations in Alox12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Alox12b APN 11 69166243 missense probably damaging 1.00
IGL02990:Alox12b APN 11 69163206 missense probably benign 0.17
IGL03106:Alox12b APN 11 69168876 nonsense probably null
R0126:Alox12b UTSW 11 69167471 missense probably benign 0.36
R0135:Alox12b UTSW 11 69162748 missense probably benign 0.06
R0305:Alox12b UTSW 11 69167379 missense probably benign 0.25
R0432:Alox12b UTSW 11 69169556 missense probably damaging 1.00
R0828:Alox12b UTSW 11 69166306 missense possibly damaging 0.89
R1139:Alox12b UTSW 11 69164405 missense probably damaging 1.00
R1558:Alox12b UTSW 11 69165885 missense probably damaging 1.00
R1870:Alox12b UTSW 11 69158373 missense possibly damaging 0.94
R4088:Alox12b UTSW 11 69158385 missense probably benign 0.14
R4195:Alox12b UTSW 11 69169600 missense probably benign 0.02
R4248:Alox12b UTSW 11 69163605 missense probably benign
R4371:Alox12b UTSW 11 69169616 missense possibly damaging 0.86
R4774:Alox12b UTSW 11 69163207 missense probably benign 0.00
R5108:Alox12b UTSW 11 69157382 missense probably benign 0.11
R5252:Alox12b UTSW 11 69165936 missense probably damaging 1.00
R5579:Alox12b UTSW 11 69162932 missense probably benign 0.04
R6000:Alox12b UTSW 11 69169568 missense probably damaging 0.98
R6168:Alox12b UTSW 11 69169634 missense probably damaging 1.00
R6322:Alox12b UTSW 11 69158373 missense possibly damaging 0.94
R6634:Alox12b UTSW 11 69168821 nonsense probably null
R7026:Alox12b UTSW 11 69157305 missense possibly damaging 0.66
X0018:Alox12b UTSW 11 69157299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTATTGCCCCTCCATCAACAAGG -3'
(R):5'- AGGTTGCACACAGGATGTTACACAC -3'

Sequencing Primer
(F):5'- CAACAAGGTCCATTTGAGTCTC -3'
(R):5'- GGATGTTACACACACATACACACTG -3'
Posted On2013-11-08