Incidental Mutation 'R0942:1810064F22Rik'
List |< first << previous [record 94 of 33389] next >> last >|
ID82754
Institutional Source Beutler Lab
Gene Symbol 1810064F22Rik
Ensembl Gene ENSMUSG00000090925
Gene NameRIKEN cDNA 1810064F22 gene
Synonyms
MMRRC Submission 039081-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R0942 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location22196963-22213860 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 22208071 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167359
SMART Domains Protein: ENSMUSP00000125899
Gene: ENSMUSG00000090925

DomainStartEndE-ValueType
Pfam:TLV_coat 6 107 2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217297
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass C T 6: 23,075,152 probably benign Het
Abcb5 C A 12: 118,906,198 V742F possibly damaging Het
Abcd4 A G 12: 84,612,828 I165T probably damaging Het
Acer3 T C 7: 98,257,742 Y119C probably damaging Het
Ap3d1 A T 10: 80,732,955 probably benign Het
Ascc2 T A 11: 4,668,380 I325N probably benign Het
Atad2b T A 12: 5,024,591 I1050N probably damaging Het
Brms1l T C 12: 55,865,957 V245A probably benign Het
Cadps2 T A 6: 23,263,562 D1270V probably damaging Het
Cdh23 A T 10: 60,410,860 M936K possibly damaging Het
Cenpj A G 14: 56,555,209 probably benign Het
Dner T C 1: 84,585,309 probably benign Het
Dzip1 T A 14: 118,887,197 R555* probably null Het
Enpp4 A T 17: 44,101,881 L254* probably null Het
Erich3 T A 3: 154,739,151 D518E probably benign Het
Gli2 G A 1: 118,837,506 R972C probably damaging Het
Gm5861 A T 5: 11,186,521 T174S probably benign Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Grb7 T C 11: 98,453,808 Y346H probably damaging Het
Heg1 T C 16: 33,760,803 L1192P probably damaging Het
Il16 T A 7: 83,663,141 Q445L probably benign Het
Il17d C T 14: 57,542,320 probably benign Het
Kmt2c A T 5: 25,315,303 N1936K probably benign Het
Lrrc45 T C 11: 120,718,238 probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mphosph9 T A 5: 124,262,037 R934* probably null Het
Nek11 T A 9: 105,295,371 probably null Het
Nf1 T C 11: 79,438,711 S634P probably benign Het
Olfr293 T A 7: 86,664,106 M148K probably damaging Het
Pkhd1l1 T C 15: 44,532,959 V1959A probably benign Het
Pkp2 G T 16: 16,226,030 G216V probably benign Het
Ppp1r16a T C 15: 76,694,011 L394P probably damaging Het
Ptprc G A 1: 138,068,401 Q1070* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rprd2 A T 3: 95,765,418 I891N probably damaging Het
Taf15 T C 11: 83,499,106 I40T probably damaging Het
Tshz1 A G 18: 84,013,053 Y1077H probably damaging Het
Ttn T C 2: 76,863,489 E223G possibly damaging Het
Other mutations in 1810064F22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0066:1810064F22Rik UTSW 9 22207881 unclassified noncoding transcript
R0066:1810064F22Rik UTSW 9 22207881 unclassified noncoding transcript
R0940:1810064F22Rik UTSW 9 22208071 unclassified noncoding transcript
R4854:1810064F22Rik UTSW 9 22208037 unclassified noncoding transcript
R5433:1810064F22Rik UTSW 9 22207743 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGTTTCCATCGAAAACCACAAGAGCTA -3'
(R):5'- GCCTCAATTGTACTGTCTGGGTCCT -3'

Sequencing Primer
(F):5'- GAAACCTGCCTACCATTAATTCTG -3'
(R):5'- ggtttggtttggtttggtttg -3'
Posted On2013-11-08