Incidental Mutation 'R0942:Heg1'
ID82773
Institutional Source Beutler Lab
Gene Symbol Heg1
Ensembl Gene ENSMUSG00000075254
Gene Nameheart development protein with EGF-like domains 1
Synonyms5530401I02Rik, 9530025L16Rik, LOC268884, 4632417D23Rik
MMRRC Submission 039081-MU
Accession Numbers

Genbank: NM_175256.5

Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R0942 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location33684370-33771576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33760803 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1192 (L1192P)
Ref Sequence ENSEMBL: ENSMUSP00000155944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126532] [ENSMUST00000128105] [ENSMUST00000152782] [ENSMUST00000232568]
Predicted Effect probably damaging
Transcript: ENSMUST00000126532
AA Change: L1216P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119790
Gene: ENSMUSG00000075254
AA Change: L1216P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
low complexity region 175 190 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 471 480 N/A INTRINSIC
low complexity region 486 502 N/A INTRINSIC
low complexity region 556 575 N/A INTRINSIC
low complexity region 637 682 N/A INTRINSIC
low complexity region 868 888 N/A INTRINSIC
EGF 944 979 4e-5 SMART
EGF_CA 981 1019 1.01e-10 SMART
EGF_like 1139 1187 6.81e1 SMART
transmembrane domain 1204 1226 N/A INTRINSIC
PDB:4HDQ|C 1312 1337 2e-10 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000128105
AA Change: L17P

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146518
Predicted Effect probably damaging
Transcript: ENSMUST00000152782
AA Change: L961P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123686
Gene: ENSMUSG00000075254
AA Change: L961P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
low complexity region 68 104 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 185 202 N/A INTRINSIC
low complexity region 301 320 N/A INTRINSIC
low complexity region 382 427 N/A INTRINSIC
low complexity region 613 633 N/A INTRINSIC
EGF 689 724 4e-5 SMART
EGF_CA 726 764 1.01e-10 SMART
EGF_like 884 932 6.81e1 SMART
transmembrane domain 949 971 N/A INTRINSIC
PDB:4HDQ|C 1057 1082 1e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152832
Predicted Effect probably damaging
Transcript: ENSMUST00000232568
AA Change: L1192P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.276 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 95% (40/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired integrity of the heart, blood vessels and lymphatic vessels, resulting in hemopericardium, lung hemorrhage, lymphangiectasis, and chylous ascites, as well as embryonic and postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Gene trapped(3)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik C T 9: 22,208,071 noncoding transcript Het
Aass C T 6: 23,075,152 probably benign Het
Abcb5 C A 12: 118,906,198 V742F possibly damaging Het
Abcd4 A G 12: 84,612,828 I165T probably damaging Het
Acer3 T C 7: 98,257,742 Y119C probably damaging Het
Ap3d1 A T 10: 80,732,955 probably benign Het
Ascc2 T A 11: 4,668,380 I325N probably benign Het
Atad2b T A 12: 5,024,591 I1050N probably damaging Het
Brms1l T C 12: 55,865,957 V245A probably benign Het
Cadps2 T A 6: 23,263,562 D1270V probably damaging Het
Cdh23 A T 10: 60,410,860 M936K possibly damaging Het
Cenpj A G 14: 56,555,209 probably benign Het
Dner T C 1: 84,585,309 probably benign Het
Dzip1 T A 14: 118,887,197 R555* probably null Het
Enpp4 A T 17: 44,101,881 L254* probably null Het
Erich3 T A 3: 154,739,151 D518E probably benign Het
Gli2 G A 1: 118,837,506 R972C probably damaging Het
Gm5861 A T 5: 11,186,521 T174S probably benign Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Grb7 T C 11: 98,453,808 Y346H probably damaging Het
Il16 T A 7: 83,663,141 Q445L probably benign Het
Il17d C T 14: 57,542,320 probably benign Het
Kmt2c A T 5: 25,315,303 N1936K probably benign Het
Lrrc45 T C 11: 120,718,238 probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mphosph9 T A 5: 124,262,037 R934* probably null Het
Nek11 T A 9: 105,295,371 probably null Het
Nf1 T C 11: 79,438,711 S634P probably benign Het
Olfr293 T A 7: 86,664,106 M148K probably damaging Het
Pkhd1l1 T C 15: 44,532,959 V1959A probably benign Het
Pkp2 G T 16: 16,226,030 G216V probably benign Het
Ppp1r16a T C 15: 76,694,011 L394P probably damaging Het
Ptprc G A 1: 138,068,401 Q1070* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rprd2 A T 3: 95,765,418 I891N probably damaging Het
Taf15 T C 11: 83,499,106 I40T probably damaging Het
Tshz1 A G 18: 84,013,053 Y1077H probably damaging Het
Ttn T C 2: 76,863,489 E223G possibly damaging Het
Other mutations in Heg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Heg1 APN 16 33710607 missense probably damaging 0.98
IGL01133:Heg1 APN 16 33727287 missense probably benign 0.01
IGL01410:Heg1 APN 16 33725566 missense possibly damaging 0.95
IGL01561:Heg1 APN 16 33766668 missense probably benign 0.27
IGL02449:Heg1 APN 16 33738725 critical splice donor site probably null
IGL02523:Heg1 APN 16 33738622 missense probably damaging 1.00
IGL02794:Heg1 APN 16 33726622 missense probably damaging 0.99
IGL03240:Heg1 APN 16 33727413 missense probably benign 0.02
I2289:Heg1 UTSW 16 33763459 missense probably damaging 1.00
R0089:Heg1 UTSW 16 33763615 missense probably damaging 1.00
R0116:Heg1 UTSW 16 33735658 splice site probably benign
R0514:Heg1 UTSW 16 33726756 missense possibly damaging 0.86
R0589:Heg1 UTSW 16 33731707 missense probably damaging 1.00
R1084:Heg1 UTSW 16 33706997 missense probably benign 0.26
R1109:Heg1 UTSW 16 33763591 missense probably damaging 1.00
R1375:Heg1 UTSW 16 33726876 missense possibly damaging 0.75
R1375:Heg1 UTSW 16 33727309 missense possibly damaging 0.60
R1550:Heg1 UTSW 16 33735553 missense probably damaging 1.00
R1720:Heg1 UTSW 16 33707179 missense probably benign 0.44
R1739:Heg1 UTSW 16 33738583 missense possibly damaging 0.94
R2068:Heg1 UTSW 16 33727590 missense probably benign 0.14
R2397:Heg1 UTSW 16 33742479 missense probably damaging 0.99
R4353:Heg1 UTSW 16 33710477 missense probably benign 0.41
R4419:Heg1 UTSW 16 33727435 missense probably benign 0.23
R4420:Heg1 UTSW 16 33727435 missense probably benign 0.23
R4779:Heg1 UTSW 16 33719772 missense probably benign 0.41
R5066:Heg1 UTSW 16 33738671 missense probably benign 0.41
R5227:Heg1 UTSW 16 33763591 missense probably damaging 1.00
R5494:Heg1 UTSW 16 33725434 missense probably benign 0.44
R5645:Heg1 UTSW 16 33706963 missense probably benign
R5708:Heg1 UTSW 16 33742404 missense probably damaging 0.99
R5934:Heg1 UTSW 16 33726919 missense probably damaging 1.00
R6074:Heg1 UTSW 16 33727203 missense possibly damaging 0.49
R6374:Heg1 UTSW 16 33727129 missense possibly damaging 0.86
R6398:Heg1 UTSW 16 33766775 missense probably damaging 0.99
R6774:Heg1 UTSW 16 33738268 missense probably damaging 1.00
R6843:Heg1 UTSW 16 33719526 missense probably benign 0.41
R7091:Heg1 UTSW 16 33726720 missense probably benign 0.01
R7183:Heg1 UTSW 16 33738550 splice site probably null
R7186:Heg1 UTSW 16 33731664 missense probably damaging 1.00
R7294:Heg1 UTSW 16 33726489 missense probably damaging 0.99
R7304:Heg1 UTSW 16 33760790 missense possibly damaging 0.52
R7405:Heg1 UTSW 16 33763449 missense possibly damaging 0.66
X0066:Heg1 UTSW 16 33727416 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGCTGAAAGAGGGAATCCTCTCACTG -3'
(R):5'- CGGCTTTGCACTTGCTTTATAGCTAAG -3'

Sequencing Primer
(F):5'- AAGCAGAACTCTAGCCTTGG -3'
(R):5'- ttcttgattcttcttgcctttcc -3'
Posted On2013-11-08