Incidental Mutation 'R0919:Osbpl7'
ID82785
Institutional Source Beutler Lab
Gene Symbol Osbpl7
Ensembl Gene ENSMUSG00000038534
Gene Nameoxysterol binding protein-like 7
Synonyms
MMRRC Submission 039069-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R0919 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location97050628-97068904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97056101 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 239 (R239H)
Ref Sequence ENSEMBL: ENSMUSP00000126902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090020] [ENSMUST00000168565]
Predicted Effect probably benign
Transcript: ENSMUST00000090020
AA Change: R410H

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000087474
Gene: ENSMUSG00000038534
AA Change: R410H

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
low complexity region 138 154 N/A INTRINSIC
PH 174 270 7.76e-11 SMART
low complexity region 533 551 N/A INTRINSIC
Pfam:Oxysterol_BP 599 947 4.6e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154084
Predicted Effect possibly damaging
Transcript: ENSMUST00000168565
AA Change: R239H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126902
Gene: ENSMUSG00000038534
AA Change: R239H

DomainStartEndE-ValueType
PH 3 99 7.76e-11 SMART
Pfam:Oxysterol_BP 427 776 8.8e-140 PFAM
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Two transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik A G 4: 10,882,462 T124A probably benign Het
Alpk2 C A 18: 65,307,473 C283F probably benign Het
Anapc1 T C 2: 128,617,731 R1803G probably benign Het
Anapc4 T C 5: 52,855,637 V423A probably benign Het
Arfgef3 A G 10: 18,589,735 I2120T possibly damaging Het
Btaf1 T A 19: 36,990,743 H1109Q probably benign Het
Cfap70 G A 14: 20,404,164 P851S probably benign Het
Clcf1 T A 19: 4,222,198 L103Q probably damaging Het
Col11a2 T A 17: 34,059,150 V1032E possibly damaging Het
Cyp2c38 T G 19: 39,404,669 D318A probably benign Het
Dbpht2 A G 12: 74,299,000 noncoding transcript Het
Dhx34 A C 7: 16,201,958 V893G probably damaging Het
Fsip2 T A 2: 82,985,484 C3854S possibly damaging Het
Htr1a T C 13: 105,444,836 Y195H probably damaging Het
Insr A G 8: 3,158,769 S1231P probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kpna4 A T 3: 69,085,828 probably benign Het
Olfr1032 A G 2: 86,008,640 Y288C possibly damaging Het
Olfr607 A G 7: 103,460,812 I132T probably damaging Het
Olfr671 A T 7: 104,975,312 Y228* probably null Het
Prkce G A 17: 86,630,160 V674I probably benign Het
Prkrip1 T C 5: 136,197,831 M52V possibly damaging Het
Sash1 A G 10: 8,730,079 M849T probably benign Het
Scaf8 T C 17: 3,197,120 L906S probably damaging Het
Sfmbt2 T C 2: 10,577,571 L676P probably benign Het
Sgsm1 C T 5: 113,258,842 V923I probably damaging Het
Slc38a3 A T 9: 107,655,959 L305Q probably damaging Het
Slc44a5 A G 3: 154,243,586 Y232C probably damaging Het
Spag17 A T 3: 100,071,943 probably benign Het
Synm T C 7: 67,735,347 I414V probably damaging Het
Tbc1d12 C T 19: 38,914,049 H551Y possibly damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Trpc7 C T 13: 56,822,649 probably benign Het
Trpm7 G A 2: 126,831,238 R532C probably damaging Het
Ttn T A 2: 76,946,742 K1485* probably null Het
Txn2 T C 15: 77,927,749 D69G probably damaging Het
U2af2 C T 7: 5,069,434 probably benign Het
Ubn1 T C 16: 5,064,391 Y239H probably damaging Het
Ubtf A G 11: 102,309,777 probably benign Het
Usp49 T A 17: 47,672,451 V127D probably benign Het
Washc2 C T 6: 116,208,264 R20W probably damaging Het
Zscan10 T C 17: 23,610,007 S476P probably damaging Het
Other mutations in Osbpl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Osbpl7 APN 11 97052300 missense probably benign 0.00
IGL02041:Osbpl7 APN 11 97060508 missense probably benign 0.08
IGL02322:Osbpl7 APN 11 97056124 missense probably benign 0.18
IGL02396:Osbpl7 APN 11 97055551 missense probably damaging 1.00
IGL02441:Osbpl7 APN 11 97067702 missense probably damaging 1.00
IGL02668:Osbpl7 APN 11 97067205 missense possibly damaging 0.90
IGL03003:Osbpl7 APN 11 97050695 missense probably benign
R0377:Osbpl7 UTSW 11 97055934 missense probably damaging 0.99
R0549:Osbpl7 UTSW 11 97067542 missense probably damaging 1.00
R0848:Osbpl7 UTSW 11 97060524 missense probably damaging 1.00
R1845:Osbpl7 UTSW 11 97059128 missense probably damaging 1.00
R2119:Osbpl7 UTSW 11 97056079 missense probably benign 0.02
R2418:Osbpl7 UTSW 11 97059178 missense probably benign 0.00
R2571:Osbpl7 UTSW 11 97054841 missense probably damaging 1.00
R3746:Osbpl7 UTSW 11 97056053 missense probably damaging 1.00
R3747:Osbpl7 UTSW 11 97056053 missense probably damaging 1.00
R3749:Osbpl7 UTSW 11 97056053 missense probably damaging 1.00
R4590:Osbpl7 UTSW 11 97056272 missense probably damaging 1.00
R4602:Osbpl7 UTSW 11 97056269 missense possibly damaging 0.77
R4857:Osbpl7 UTSW 11 97056669 intron probably benign
R4898:Osbpl7 UTSW 11 97060150 missense probably damaging 0.98
R5160:Osbpl7 UTSW 11 97054556 missense probably damaging 1.00
R5292:Osbpl7 UTSW 11 97067953 missense probably benign 0.07
R5685:Osbpl7 UTSW 11 97060277 missense probably damaging 1.00
R5786:Osbpl7 UTSW 11 97065832 missense probably damaging 1.00
R6030:Osbpl7 UTSW 11 97052261 missense probably benign 0.15
R6030:Osbpl7 UTSW 11 97052261 missense probably benign 0.15
R6038:Osbpl7 UTSW 11 97050716 missense probably benign
R6038:Osbpl7 UTSW 11 97050716 missense probably benign
R6239:Osbpl7 UTSW 11 97052824 critical splice donor site probably null
R6715:Osbpl7 UTSW 11 97054599 missense probably damaging 1.00
R6920:Osbpl7 UTSW 11 97050758 missense probably damaging 0.99
R7179:Osbpl7 UTSW 11 97050836 missense probably benign 0.05
R7222:Osbpl7 UTSW 11 97060538 missense probably damaging 1.00
R7413:Osbpl7 UTSW 11 97054878 critical splice donor site probably null
X0020:Osbpl7 UTSW 11 97056559 missense probably benign 0.01
X0060:Osbpl7 UTSW 11 97060510 nonsense probably null
X0062:Osbpl7 UTSW 11 97065643 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCGCCAAGGATGACACCATCG -3'
(R):5'- AGATTTTGCCAAAGGGACCCTCAG -3'

Sequencing Primer
(F):5'- ATGACACCATCGGACGGG -3'
(R):5'- AAGGGACCCTCAGTCCTTAGTC -3'
Posted On2013-11-08