Incidental Mutation 'R0919:Ubn1'
ID82793
Institutional Source Beutler Lab
Gene Symbol Ubn1
Ensembl Gene ENSMUSG00000039473
Gene Nameubinuclein 1
Synonyms1110029L11Rik, 2610108L02Rik
MMRRC Submission 039069-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.633) question?
Stock #R0919 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location5050057-5086289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5064391 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 239 (Y239H)
Ref Sequence ENSEMBL: ENSMUSP00000155223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052449] [ENSMUST00000229126] [ENSMUST00000229570] [ENSMUST00000230703]
Predicted Effect probably damaging
Transcript: ENSMUST00000052449
AA Change: Y239H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061843
Gene: ENSMUSG00000039473
AA Change: Y239H

DomainStartEndE-ValueType
Pfam:HUN 117 168 1.4e-22 PFAM
low complexity region 181 224 N/A INTRINSIC
low complexity region 232 238 N/A INTRINSIC
low complexity region 250 267 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
Pfam:UBN_AB 353 573 2.4e-80 PFAM
low complexity region 792 804 N/A INTRINSIC
low complexity region 856 882 N/A INTRINSIC
low complexity region 905 934 N/A INTRINSIC
low complexity region 970 984 N/A INTRINSIC
low complexity region 996 1006 N/A INTRINSIC
low complexity region 1016 1034 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229060
Predicted Effect probably damaging
Transcript: ENSMUST00000229126
AA Change: Y239H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000229570
Predicted Effect probably damaging
Transcript: ENSMUST00000230703
AA Change: Y239H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cellular senescence is a hallmark of tumor suppression and tissue aging. Senescent cells contain domains of heterochromatin, called senescence-associated heterochromatin foci (SAHF), that repress proliferation-promoting genes. The protein encoded by this gene binds to proliferation-promoting genes and is required for SAHF formation, enhancing methylation of histone H3. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik A G 4: 10,882,462 T124A probably benign Het
Alpk2 C A 18: 65,307,473 C283F probably benign Het
Anapc1 T C 2: 128,617,731 R1803G probably benign Het
Anapc4 T C 5: 52,855,637 V423A probably benign Het
Arfgef3 A G 10: 18,589,735 I2120T possibly damaging Het
Btaf1 T A 19: 36,990,743 H1109Q probably benign Het
Cfap70 G A 14: 20,404,164 P851S probably benign Het
Clcf1 T A 19: 4,222,198 L103Q probably damaging Het
Col11a2 T A 17: 34,059,150 V1032E possibly damaging Het
Cyp2c38 T G 19: 39,404,669 D318A probably benign Het
Dbpht2 A G 12: 74,299,000 noncoding transcript Het
Dhx34 A C 7: 16,201,958 V893G probably damaging Het
Fsip2 T A 2: 82,985,484 C3854S possibly damaging Het
Htr1a T C 13: 105,444,836 Y195H probably damaging Het
Insr A G 8: 3,158,769 S1231P probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kpna4 A T 3: 69,085,828 probably benign Het
Olfr1032 A G 2: 86,008,640 Y288C possibly damaging Het
Olfr607 A G 7: 103,460,812 I132T probably damaging Het
Olfr671 A T 7: 104,975,312 Y228* probably null Het
Osbpl7 G A 11: 97,056,101 R239H possibly damaging Het
Prkce G A 17: 86,630,160 V674I probably benign Het
Prkrip1 T C 5: 136,197,831 M52V possibly damaging Het
Sash1 A G 10: 8,730,079 M849T probably benign Het
Scaf8 T C 17: 3,197,120 L906S probably damaging Het
Sfmbt2 T C 2: 10,577,571 L676P probably benign Het
Sgsm1 C T 5: 113,258,842 V923I probably damaging Het
Slc38a3 A T 9: 107,655,959 L305Q probably damaging Het
Slc44a5 A G 3: 154,243,586 Y232C probably damaging Het
Spag17 A T 3: 100,071,943 probably benign Het
Synm T C 7: 67,735,347 I414V probably damaging Het
Tbc1d12 C T 19: 38,914,049 H551Y possibly damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Trpc7 C T 13: 56,822,649 probably benign Het
Trpm7 G A 2: 126,831,238 R532C probably damaging Het
Ttn T A 2: 76,946,742 K1485* probably null Het
Txn2 T C 15: 77,927,749 D69G probably damaging Het
U2af2 C T 7: 5,069,434 probably benign Het
Ubtf A G 11: 102,309,777 probably benign Het
Usp49 T A 17: 47,672,451 V127D probably benign Het
Washc2 C T 6: 116,208,264 R20W probably damaging Het
Zscan10 T C 17: 23,610,007 S476P probably damaging Het
Other mutations in Ubn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ubn1 APN 16 5081914 missense probably benign 0.00
IGL01726:Ubn1 APN 16 5073470 critical splice donor site probably null
IGL01744:Ubn1 APN 16 5072059 missense probably damaging 1.00
IGL01777:Ubn1 APN 16 5072149 missense possibly damaging 0.46
IGL02110:Ubn1 APN 16 5081890 splice site probably benign
IGL02667:Ubn1 APN 16 5062599 missense probably damaging 1.00
IGL03345:Ubn1 APN 16 5081964 missense probably damaging 0.98
R0201:Ubn1 UTSW 16 5064614 missense probably damaging 1.00
R0437:Ubn1 UTSW 16 5072184 critical splice donor site probably benign
R0514:Ubn1 UTSW 16 5073071 missense probably damaging 1.00
R0550:Ubn1 UTSW 16 5062620 unclassified probably null
R1183:Ubn1 UTSW 16 5064542 missense probably damaging 1.00
R1339:Ubn1 UTSW 16 5055335 missense probably damaging 0.99
R1440:Ubn1 UTSW 16 5077294 missense probably damaging 1.00
R1836:Ubn1 UTSW 16 5077391 missense probably benign
R2024:Ubn1 UTSW 16 5064623 missense probably damaging 1.00
R2026:Ubn1 UTSW 16 5064650 missense probably damaging 1.00
R2105:Ubn1 UTSW 16 5077224 nonsense probably null
R2896:Ubn1 UTSW 16 5055219 missense possibly damaging 0.60
R3418:Ubn1 UTSW 16 5074379 splice site probably benign
R3721:Ubn1 UTSW 16 5073378 missense possibly damaging 0.59
R4033:Ubn1 UTSW 16 5064611 missense probably damaging 1.00
R4398:Ubn1 UTSW 16 5064425 missense probably damaging 0.99
R4547:Ubn1 UTSW 16 5072092 missense probably damaging 1.00
R4646:Ubn1 UTSW 16 5077987 missense probably damaging 0.99
R4870:Ubn1 UTSW 16 5077313 missense probably damaging 1.00
R5018:Ubn1 UTSW 16 5063725 missense probably damaging 1.00
R5220:Ubn1 UTSW 16 5077954 missense probably benign 0.02
R5394:Ubn1 UTSW 16 5074369 missense possibly damaging 0.51
R6217:Ubn1 UTSW 16 5077232 missense probably damaging 1.00
R6372:Ubn1 UTSW 16 5081638 missense possibly damaging 0.84
R6418:Ubn1 UTSW 16 5081927 missense probably benign
R6823:Ubn1 UTSW 16 5064547 missense probably damaging 1.00
R7028:Ubn1 UTSW 16 5055324 missense probably damaging 1.00
R7203:Ubn1 UTSW 16 5077216 missense possibly damaging 0.57
X0067:Ubn1 UTSW 16 5055338 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCAGCAAGAACAAGTTCTCTTTGCC -3'
(R):5'- TGCTCCAAGTCCAAATCCGTCAG -3'

Sequencing Primer
(F):5'- AGTTCTCTTTGCCAAAAGGATGG -3'
(R):5'- CAGCTTGGAGCAAGTCATTGTC -3'
Posted On2013-11-08